In spite of the advances in preventive dentistry, dental caries still remains a major dental health problem in several countries [1–4]. It is important to assess the microbial counts in saliva and plaque during primary and mixed dentition period to both predict and prevent dental caries.
Although a positive correlation has been shown between caries experience and mutans streptococci levels in an individual [5,6], some studies have also shown higher levels of these organisms in populations with a very low caries experience [7]. This can be explained by the presence of different species of mutans streptococci which exhibit variable virulence and adherence properties [8].
To better understand the role of these organisms, we need efficient methods to detect and identify them. Various methods have been proposed to identify and differentiate oral streptococci including culture methods, biochemical tests, immunological and genetic methods with DNA probes, enzyme linked immunosorbent assay and Polymerase Chain Reaction (PCR) [11].
DNA based methods such as PCR method, have proved to be universally applicable for the detection of cariogenic bacteria in various epidemiological and clinical studies because of their high sensitivity, specificity and rapidity in obtaining results [13].
Several selective culture media have been developed for the enumeration of mutans streptococci in saliva and plaque. Modified Sucrose-Bacitracin (SB-20M) culture medium is a suitable media which shows morphological differences between colonies of S. mutans and S. sobrinus [14].
Materials and Methods
The present in-vivo study was conducted in the Department of Pedodontics and Preventive Dentistry at I.T.S., Centre for Dental Studies and Research, Ghaziabad, Uttar Pradesh, India, over a period of one year and was approved by Institutional Ethics Research Committee. Children in the age group of 3-5 years from various schools of Ghaziabad were screened using WHO diagnostic criteria to determine the dmft (decayed, missing, filled teeth) index. Children with good general health, CA (dmft≥4) and CF (dmft=0) were included in the study. Those who suffered from any systemic disease, had taken antibiotics in the past three months or medically compromised children were excluded from the study.
A pilot study was conducted and it was found that the Mean±S.D of number of CFU/ml for CA and CF groups were 88160.59±137207.5 and 9236.25±13634.45 respectively. With the help of software G*Power analysis version 3.1.9.2 for the power 0.95 and α err probability 0.05, sample size of 34 samples for each group was determined.
Sixty-eight children were selected for participation in the study based on their caries experience and were classified in two groups of 34 children each. Group A consisted of CA children (dmft≥4) and Group B consisted of CF children (dmft=0).
Supragingival plaque samples were collected by a single operator from each subject along the cervical margin of all teeth with the help of a sterile dental explorer. Each explorer was immediately placed in a sterile tube containing phosphate-buffered saline (pH=7) and transported in ice pack at 4°C to Codon Biotech Laboratory, Noida, Uttar Pradesh, India, where this sample was used for two independent procedures – PCR and plate count using SB-20M agar medium.
I) Detection of micro-organisms (S. mutans and S. sobrinus) by PCR method: DNA was extracted from the plaque sample using the standard procedure where bacterial cells from the suspension were first lysed with lysis solution containing lysozyme + Sodium Dodecyl Sulphate (SDS) + NaOH followed by addition of Potassium acetate (neutralizing solution) which precipitates the proteins. Then the chromosomal DNA was precipitated with isopropyl alcohol and stored in Tris buffer for further use in amplification.
Two sets of species specific primers synthesized by “Sigma Aldrich, USA” were used in the study. These were as follows -GTFB-F5’-ACTACACTTTCGGGTGGCTTGG,GTFB-R5’ CAGTATAAGCGCCAGTTTCATC for amplification of 517 bp-DNA fragment of the gtf B gene of S. mutans, and GTFI-F5’-GATAACTACCTGACAGCTGACT,GTFI-R5’-AAGCTG CCTTAAGGTAATCACT for amplification of 712 bp-DNA fragment of the gtf I gene of S. sobrinus.
The PCR conditions used were denaturation at 95°C for 30 seconds, followed by annealing at 59°C for 30 seconds, and extension at 72°C for 1 minute. This amplification was repeated for 30 cycles. The final cycle was run at 72°C for 5 minutes. The PCR products obtained were subjected to electrophoresis on 1.5% agarose gel along with 100-bp DNA ladder marker. The gel was stained with ethidium bromide and illuminated under UV illuminator. The presence and absence of the type of bacteria was seen by the presence of amplified bands on the agarose gel.
II) Quantification of the two strains using SB-20M agar medium: Dental plaque samples were vortexed for 30 seconds, then serial diluted from 10-1 to 10-6 and spread plated on SB-20M culture medium.
The plates were incubated in an atmosphere of 10% CO2 at room temperature for 48 hours. Since, SB-20M media is a differential media, both the bacterial cultures can be very easily differentiated on the agar due to their colonial and morphological difference. S. mutans colonies show a granular surface with polysaccharide drops while S. sobrinus colonies appear in the form of circular, opaque, milky drops.
The Colony Forming Units (CFU) were examined visually and counted using colony counter to verify the presence of CFU resembling S. mutans and S. sobrinus and results were described as CFU/ml.
Statistical Analysis
The data were analyzed using statistical software SPSS version 16. For statistical analysis, the frequencies and means of CFU were used with CI = 95%. For bivariate analysis, Fisher exact test was used at 5% level of significance. The comparison of mean of number of CFU of S. mutans and S. sobrinus was made by Mann Whitney U test. Spearman’s Rho test at 1% level of significance was used for correlation between dmft and CFU in CA group.
Results
The distribution of bacteria among CA and CF individuals found by PCR method is shown in [Table/Fig-1]. Sixty-eight children (37 boys, 31 girls) participated in the study with the mean age of 4.38 years.
Distribution of bacteria among caries active and caries free individuals found by PCR method.
| Microorganisms Present | Caries Active | Caries Free |
|---|
| S. mutans | S. sobrinus | Frequency (%) | Frequency (%) |
|---|
| + | - | 8 (23.5) | 25 (73.5) |
| - | + | 3 (8.8) | 0 |
| + | + | 20 (58.8) | 4 (11.7) |
| - | - | 3 (8.8) | 5 (14.7) |
| Total samples | 34 | 34 |
Frequency of detection of S. mutans and S. sobrinus by PCR method (n=68) [Table/Fig-2]: The S. mutans was found to be present in 82.4% of CA children and 85.3% of CF children and this difference was found to be statistically non-significant (p>0.05). However, S. sobrinus was present in 67.6% of CA children and 11.8% of CF children and the difference was highly significant (p<0.001). In 58.8% of the CA children, both S. mutans and S. sobrinus were detected as against 11.7% children in CF group and this difference was also found to be statistically significant (p<0.05).
Frequencies of identification of S. mutans and S. sobrinus from dental plaque by PCR in caries active and caries free children (n=68).
| Variable | Caries Active Group | Caries Free Group | p-value |
|---|
| S. mutans | Present | Frequency | 28 | 29 | 0.50* |
| % within group | 82.4 | 85.3 |
| Absent | Frequency | 6 | 5 |
| % within group | 17.6 | 14.7 |
| S. sobrinus | Present | Frequency | 23 | 4 | 0.000*** |
| % within group | 67.6 | 11.8 |
| Absent | Frequency | 11 | 30 |
| % within group | 32.4 | 88.2 |
| S. mutans & S. sobrinus | Present | Frequency | 20 | 4 | 0.02** |
| % within group | 58.8 | 11.7 |
| Absent | Frequency | 3 | 5 |
| % within group | 8.8 | 14.7 |
*NS, ** significant at 0.05, *** significant at 0.001 (Fisher exact test at 5% level of significance)
Quantification of S. mutans and S. sobrinus in both groups from SB-20M agar plates [Table/Fig-3]: The values of mean ranks for the CFU of S. mutans and S. sobrinus in both the groups. Mann Whitney statistics did not show any significant difference between two groups for the CFU of S. mutans (p>0.05).
Distribution of mean ranks of CFU of S. mutans and S. sobrinus in caries active and caries free group.
| Group | N | Mean Rank | Z value | p-value |
|---|
| CFUS. mutans | Caries Active | 28 | 31.95 | -1.582 | 0.11NS |
| Caries Free | 29 | 25.05 |
| CFUS. sobrinus | Caries Active | 23 | 15.24 | -1.945 | 0.04* |
| Caries Free | 4 | 6.88 |
*Significant p <0.05, NS Not Significant p > 0.05, (Mann Whitney U test used)
On the other hand, colony counts for S. sobrinus were found to be significantly greater in the CA group (p<0.05).
Correlation of CFU of S. mutans and S. sobrinus with dmft in CA children [Table/Fig-4]: A negative correlation although statistically insignificant was found between the dmft and CFU of S. mutans. However, the correlation of dmft was positively correlated with CFU of S. sobrinus (p<0.001) and combined S. mutans and S. sobrinus (p<0.01).
Correlation of CFU of S. mutans, S. sobrinus and both with dmft index within caries active group.
| dmft Correlation | CFUS. mutans | CFUS. sobrinus | CFUS. mutans & S. sobrinus |
|---|
| Correlation Coefficient (r) | -0.296 | 0.895 | 0.602 |
| p-value | 0.126 NS | 0.000* | 0.005* |
*Significant p <0.05, NS Not Significant p > 0.05
(Spearman’s Rho Test used at 1% level of significance)
Discussion
Dental caries is a multifactorial infectious disease and is still considered as one of the most prevalent biofilm-mediated diseases affecting humans. The most important risk factor in any disease is the causative agent [15].
Among the mutans streptococci group, S. mutans and S. sobrinus are the most frequently isolated species from human dental plaque and are believed to be the major aetiological agents for tooth decay. These micro-organisms have the capability of adhering to the enamel surface and forming a bio-film facilitated by extracellular polysaccharides produced by using sugars in the diet as a substrate, which favours demineralization measured by the acid products from bacterial metabolism [16].
In the present study, dental plaque was used for the detection of cariogenic micro-organisms rather than saliva. Various previous studies have used saliva for detecting cariogenic bacteria; however, the tendency in recent studies has been towards the use of dental plaque. As the intention was to relate the presence of cariogenic bacteria and dental caries, it was found that using saliva as a source of cariogenic bacteria does not permit establishing an effective association. Although the presence of S. mutans is high in saliva, it is lower on the surface of enamel, where this bacterium actually manifests its capacity to produce acids and result in subsequent demineralization [16].
The present study showed that S. mutans alone was present in 23.5% of CA children and 73.5% of CF children. The distribution of S. mutans in previous studies was quite variable with the values ranging from 24-64% in CA children and was present up to 76% in CF children [11,17,18]. Comparison with other similar studies has been shown in [Table/Fig-5].
Other studies for the presence of Streptococus mutans.
| Study | Caries Active Samples | Caries Free Samples | Result |
|---|
| Rodriguez J et al., (2007) [15] | 75% | 60% | NS |
| Choi EJ et al., (2009) [20] | 100% | 80% | NS |
| Carmona LE et al., (2011) [16] | 76% | 24% | S |
| Soni H and Vasavada M (2015) [21] | 100% | 100% | NS |
In the present study, S. sobrinus alone was present only in 8.8% of CA children and in none of the samples of CF children. However, in a previous study by Nurelhuda NM et al., [11], S. sobrinus was never present alone in any of the samples. Other comparative studies have been compiled in [Table/Fig-6].
Other studies for the presence to Streptococcus sobrinus.
| Study | Caries Active Samples | Caries Free Samples | Result |
|---|
| Rodriguez J et al., (2007) [15] | 50% | 22.5% | S |
| Choi EJ et al., (2009) [20] | 43-60% | 8.6% | S |
| Carmona LE et al., (2011) [16] | 81.9% | 18.1% | S |
| Soni H and Vasavada M (2015) [21] | 60% | 30% | S |
A significant finding of the present study was presence of both S. mutans and S. sobrinus in 58.8% of CA group was almost five times more than CF group and this finding correlates with previous studies as well [11]. Thus, the presence of both the bacteria together can be considered an important pathogenic factor in the development of carious lesions.
At the same time, S. sobrinus was found six times more frequently in CA group when assessed by PCR method; whereas, the frequency of S. mutans was not statistically significant between the two groups. Thus, it is not only important to assess the total bacterial load but also the presence of individual species which can dictate the disease outcome. Similar results were obtained on comparing the CFU from SB-20M medium. The difference in CFU of S. mutans between the two groups was not statistically significant while it was significantly more for S. sobrinus in CA group. Thus, from this study it can be concluded that S. sobrinus has a higher cariogenic potential than S. mutans. Similar conclusions have been drawn from previous experiments done on animals [19] and also from studies carried out in pre-school children [12].
On comparing the results obtained from PCR method and SB-20M agar plates, similar distribution of S. mutans and S. sobrinus was found and the difference between the two methods was not statistically significant. There was only one sample from CF group where S. mutans was detected by PCR and missed in plate analysis. Thus, both the methods are equally effective in detecting the individual species.
In the CA group, a positive correlation was found between dmft index and CFU of S. sobrinus and S. sobrinus/S. mutans (combined). On the contrary, no correlation could be established between S. mutans and dmft; thus, again emphasizing on the fact that severity of the disease can also be affected by increase in amount of certain specific species of bacteria. This finding is supported by Choi EJ et al., who concluded that S. sobrinus was more related to dental caries than S. mutans [20].
Limitation
The limitation in the present study was that the sample size was small and only two species of mutans streptococci were tested. More studies are needed to evaluate other species of mutans streptococci and correlate them with caries experience in children.
Conclusion
From the present study, it can be concluded that both SB-20M agar medium and PCR method are equally effective in detecting S. mutans and S. sobrinus from plaque samples. It is also concluded from this study that S. sobrinus might play a more active role in the pathogenesis of dental caries as compared to S. mutans; thus, giving importance to the detection of individual species while assessing caries susceptibility of an individual.
*NS, ** significant at 0.05, *** significant at 0.001 (Fisher exact test at 5% level of significance)*Significant p <0.05, NS Not Significant p > 0.05, (Mann Whitney U test used)*Significant p <0.05, NS Not Significant p > 0.05(Spearman’s Rho Test used at 1% level of significance)