This was a longitudinal study conducted at Institute of Liver and Biliary Sciences, a tertiary liver care hospital in New Delhi in July and August 2012. The approval for the study was obtained from the Institutional Review Board and Ethics Committee. The study was conducted according to the official guidelines for blood donation as approved by the Ministry of Health and Family Welfare, Government of India.

A total of 200 blood donors were recruited in the study after informed consent was obtained. A standardized questionnaire was used to enquire whether the donor had experienced any symptoms compatible with a viral illness during the previous one year. Data regarding clinical and demographic characteristics was collected. Four ml blood was obtained from each subject. The samples were centrifuged at 2000rpm for 10minutes and were stored in aliquots at -80^OC for further testing. All the samples were screened using a commercially available anti-dengue IgM and IgG capture ELISA (Novatec, Germany). The assays were carried out as per manufacturer’s instructions. Test samples with optical density values equal to or greater than the cut-off value (1.1) were considered to be reactive.

The samples were also amplified using semi-nested reverse transcriptase polymerase chain (RT-PCR). Nucleic acid extraction was done using QIAamp Viral RNA Mini Kit (Qiagen, Germany) as per the manufacturer’s protocol. The extracted viral RNA was reverse transcribed to cDNA using transcriptor first strand cDNA synthesis kit (Roche, Germany), and then amplified in the external round of RT-PCR using dengue virus consensus primers (D1: 5’ TCAATATGCTGAAACGCGCGAGAAACCG 3’; D2: 5’ TTGCACCAACAGTCAATGTCT TCAGGT TC 3’) in 25μl reaction volume. The DNA product obtained was of 511bp. Subsequent amplification of cDNA was carried out with the dengue virus consensus forward primer (D1) and four dengue serotype-specific reverse primers; TS (type specific) 1: 5’ CGTCTCAGTGATCCGGGGA 3’; TS-2: 5’ CGCCACAAGGGCCATGAACAG 3’; TS 3: 5’ TAACATCATCATGAGACAGAGC 3’; TS 4: 5’CTCTGTTGTCTTAAACAAGAGA 3’ [12]. All the 4 serotype-specific primers were added in a single reaction mixture. A 1:20 dilution of the external PCR product was used in the nested PCR reaction. The amplification was carried out for 30 cycles at 94^OC for 30 seconds, 55^OC for 1 minute and 72^OC for 2 minutes. Dengue virus serotypes were identified by the size of the bands obtained in gel electrophoresis (DENV 1– 482 bp, DENV 2–119 bp, DENV 3–290 bp, DENV 4–392 bp). Results were entered using Microsoft Excel and expressed as mean, median and percentages.

Of the 200 blood donors recruited in the study, most were men (97%). Median age for blood donors was 28 years (range 19–51 years) [Table/Fig-1]. Serologic evidence of past dengue infection (anti-DENV IgG) was identified in 58% of blood donors (n = 116 cases). Twenty seven of 200 serum samples from asymptomatic donors were reactive to anti-DENV IgM by ELISA (13.5%). Twenty five samples (12.5%) tested positive for both IgG and IgM, while only two (1%) tested positive for IgM alone. At the time of blood donation none of the IgM positive patients had any symptoms compatible with the presence of a viral illness. On screening using Nested RT-PCR none of the blood donors were found to be viremic at the time of donation [Table/Fig-2].

After entering the body via a mosquito bite, dengue virus replicates in the mononuclear macrophage cells for a period of 3 to 14 days before the symptoms appear. The period of viremia lasts for about 5 to 7 days and roughly corresponds to the period of fever. It is during this phase that dengue can become a blood-borne infection [7]. There are many reports of transmission of dengue through infected blood [8,9]. It has been shown that transmission of the virus can also occur through organ transplant [10,11]. In fact, cases of needlestick injury related nosocomial acquisition of dengue have also been documented [13,14]. Mucocutaneous exposure to infected blood has also led to transmission of the infection [15]. Tambyah et al., described a cluster of cases of dengue associated with blood transfusion in Singapore [9].

Despite the fact that there exists substantial evidence for its transmission by blood and blood products, dengue is not considered a threat to blood safety. The risk of transfusion transmitted dengue varies from country to country as per the geographic endemicity and immunity in the population. The level of viremia, which is expected to be lower and shorter in asymptomatic individuals, may also impact the efficiency of transmission by transfusion [16].

Transfusion of dengue infected blood or even exposed blood with dengue specific antibodies may be of concern in certain groups of patients especially immunocompromised and with chronic liver diseases. Since hepatic dysfunction is a well recognised feature of dengue [17], it is prudent to mention that the transfusion of dengue infected blood may cause deterioration of patients with acute or chronic liver diseases. It is not just the virus, but also the transfer of antibodies which is a matter of concern. It has been proposed that the transfer of non-neutralising or partially neutralizing antibodies while blood transfusion may lead to antibody dependant enhancement in case the recipient is later exposed to heterotypic dengue infection, precipitating dengue haemorrhagic fever and shock [18].

This study has shown that viremia in asymptomatic blood donors was absent, therefore the need to screen blood donors by serological assays for dengue and it may be debatable. But the seroprevalence of infection was 58% which generates concern over the implementation of vaccination in our population. A clear increase in dengue IgG prevalence with age was observed, ranging from 46% in cases less than 30-year-old to 100% in those over 50 years. No difference in the seroprevalence rates in urban versus rural areas was seen, which could have been because of the very low number of donors coming from rural areas (26 out of 200).

Large community based seroprevalence studies are required to estimate the true burden of infection in a population. Periodically conducted serosurveys would also serve as a measure to evaluate the efficacy of control programs. Additionally, the sero-epidemiological prevalence of infection in general population/blood donors may also serve as an important feeder of information before implementation of any vaccination policies. Notably, the Sanofi Pasteur dengue vaccine recently licensed in Mexico is meant for areas that are highly endemic, with a seroprevalence over 60% [19]. There is definite lack of literature regarding seroepidemiology of dengue in healthy population from our country. In a population based seroprevalence study from Pakistan, 67.2% dengue IgG positivity was seen [20]. A few studies have been done across the globe to estimate the burden of dengue infection in blood donors [Table/Fig-3] [18,21–28]. While studies from Brazil, Puerto Rico and Australia have shown very low prevalence in blood donors [21–25], high seroprevalence has been reported from Malaysia [26] and Singapore [27] (42% and 52% respectively). However, the two studies did not screen the donors for active viremia. In another study from Delhi [27] blood donors were tested for NS1 antigen, but no positivity was seen.

The study has been conducted on a small sample size which may not be depictive of seroprevalence in the general polulation. Studies of larger magnitude are required to quantify the risk and provide strong evidence for policies to be made.

In the present era where transfusion safety in terms of HBV, HCV and HIV is given paramount importance, the risk of transmission of the dengue virus and/or its antibodies has been increasingly perceived. Despite high seroprevalence of anti-dengue antibodies in the study subjects, active viremia was not seen. Mandatory screening for dengue before blood transfusion may not be feasible in a resource limited setting. Stringent questioning and deferral of donors with history compatible with a viral illness is crucial.