Introduction
Carcinoma (CA) of the Gallbladder commonly occurs in elderly patients; most tumours are diagnosed at advanced stage and carry poor prognosis [1]. It is a great diagnostic and therapeutic challenge for surgeons as 5 year survival of patients in most series is < 5% and median survival is < 6 months [1,2].
The incidence of CA Gallbladder varies widely in different geographic regions, and racial and ethnic groups. The incidence is highest in Chile, North-east Europe, Israeli Jews, and Americans of Indian and Mexican origin [3]. In India, it is the most common form of biliary malignancy and third most common CA of the digestive tract in Eastern UP and Western Bihar [4] and fifth most common gastrointestinal CA in women [5-7].
It is well established that gastrin and cholecystokinin (CCK) are trophic for various gastrointestinal malignancies [8-10]. It is also known that gallbladder has high concentration of Cholecystokinin-A (CCK-A) receptors [11]. CCK-A receptor does not modulate the susceptibility of cancer gallbladder [12]. But their role in gallbladder malignancy remains undecided. Molecular studies in high incidence areas, and in subsets of high risk gallbladder disease patients, may help to predict the possibility of gall stone disease developing into cancer and may dictate for measures to be taken in developing new screening or therapeutic strategies.
“The aim of this study was to find out expression of CCK receptors in two common gallbladder diseases in adults”. The objectives were as follows.
Objectives
To identify expression of cholecystokinin receptors, CCK-A and CCK-B, in the gallbladder tissue and blood of patients suffering from CA gallbladder and cholelithiasis.
To compare expression of these receptors in above disease states in similar samples of healthy subjects.
Materials and Methods
This prospective study was conducted in the Department of General Surgery, Era’s Lucknow Medical College and Hospital, Lucknow, India from March 2008 to December 2009, after obtaining approval from the Ethical Committee of the institution. Patients’ samples were also taken from Chhatrapati Shahuji Maharaj Medical University (CSMMU), Lucknow, India. The analysis of CCK –A and CCK-B receptors was done in the Indian Institute of Toxicology Research (IITR), Lucknow, India.
In all, 49 cases were recruited, after obtaining informed consent. They included 22 patients of cancer gall bladder, 19 cases of cholecystitis with cholelithiasis and eight normal gallbladders; which were obtained from patients operated for trauma of the biliary system or Whipple’s procedure, and served as control. Demographic data of all the cases were maintained. Gall bladder tissue and blood samples were taken from all patients and control subjects.
Ultrasound (USG) abdomen of all patients was done prior to surgery. CT scan abdomen was carried out in only those patients in whom suspicion of CA gallbladder was present on ultrasound examination of the abdomen.
CCK-A and CCK-B receptors analysis: Gallbladder tissue samples were obtained and immediately submerged in Trizol solution for storage without jeopardizing the quality or quantity of RNA. Tissue pieces were taken in 600 μl of Trizol solution. The volume of tissue was 1/10th of Trizol solution and stored at -80°C for analysis of CCK receptors. Rest of the gallbladder tissue was sent for histopathological examination.
Two ml of venous blood was taken from all above patients and control subjects in an EDTA vial and immediately 100 μl of EDTA blood was put in 600 μl of Trizol solution and stored at -80° C for analysis of CCK receptors. In advanced inoperable cases of CA gallbladder only blood samples were taken from the patients.
Total RNA was extracted to study the expression of CCK-A and CCK-B receptors by RT-PCR (Reverse Transcriptase- PCR) and the quantization was done by Real Time PCR using SYBR green based chemistry.
Method of Rnaextraction
Samples collected and stored in Trizol solutions at -80oC were homogenized. Transferred 200 μl of homogenized sample to a vial containing 600 μl of Trizol, and then proceeded as follows:
Homogenized once more
120 μl of chloroform was added in each vial.
Vortex for 15 seconds.
Incubated at room temperature for 15 minutes
Centrifuged the mixture at 10,000 Xg for 15 minutes. The mixture was separated into 3 phases. The colourless upper aqueous phase (containing the RNA), the semisolid inter phase (containing most of the DNA) and the lower organic phase.
Without disturbing the inter phase, carefully transferred the aqueous phase, into tube containing 500 μl of Isopropanol, mixed gently and incubated at room temperature for 10 minutes.
Centrifuged at 10,000 Xg for 15 minutes. Pellet was visualized at the base containing RNA precipitate and the supernatant was discarded.
Wash the pellet with 1 ml of 80% ethanol and supernatant was discarded.
Air-dried the pellet for about 30-60 min: at room temperature.
Pellet was dissolved in 100 μl of Diethylpyrocarbonate (DEPC) water. (RNAse free)
Quantification of RNA was done with the help of Pico drop.
The RNA which was extracted in pellet form was used for cDNA formation.
RT–PCR of CCK-A and CCK-B receptors: RNA sample was reverse transcribed into first strand complementary DNA (cDNA) using the Revert Aid H minus First Strand cDNA synthesis kit, Cat No. - K1632 (Fermentas Life Sciences, Canada). 20 μl of cDNA was prepared of each sample by using MJ Research, PTC 200 DNA Engine using 1 cycle of 60 min at 42°C and 1 cycle of 10 min at 70°C.
Real Time-PCR was performed on first strand cDNA (2.0 μl) using 1 cycle of 20 sec at 95°C, 35 cycles of 20 sec at 95°C, 20 sec at 58°C, 30 sec at 72°C and 1 cycle of 1 min at 95°C, 30 sec at 55°C, 30 sec at 95°C, using Stratagene Mx 3000P.
Ct value was obtained of each sample and ΔCt was calculated.
Ct = threshold Cycle, PCR cycle at which an increase in reporter fluorescence above a baseline signal is first detected (cycle when fluorescence crosses the threshold)
Calculation
ΔCt (sample) = Ct (Target) - Ct (Reference)
Where Target – CCK-A and CCK-B receptor, Reference-β-actin
The PCR products were electrophoresed on 2% agarose Tris-boric acid EDTA gel containing ethidium bromide (3 μl from 10 mg/ml stock in a volume of 35 ml).
The PCR amplification primers for the CCK-A and CCK-B genes were chosen (LifeTech AuPre P oligos, USA) and were based on the gene sequences published by de Weerth and colleagues [13] and Pisegna and associates [14]. The CCK-A fragment was of 320 base pair (bp) while CCK-B and â-actin fragment was of 430 bp and 410 bp respectively [13,14]. Following primers were used:
CCK-A primer pair, forward: 5´CCTACGACACCGCCTCCGC3´,
reverse: 5´TCCGTTCTTTCTTCTCTGCCTCCT3´.
CCK-B primer pair, forward: 5´ACCCCAACGACAGGAAAA-GGT3´,
reverse: 5´TTTGGGAAGGAAGGAGA-GGGC3´.
β-actin primer pair, forward: 5´CGACAGCAGTTGGTTGGAGC3
reverse: 5´GGTCTCAAGTCAGTGTACAG3´
statistical analysis
SPSS version 17 software was used for statistical analysis. Following tests were applied. Mean and Standard Deviation, Chi-square test for comparing two qualitative values, and ANOVA test for comparing multiple values were carried out {and if p<0.05 than Dunnett-C test, otherwise Tukey’s test}.
Results
Total 49 cases were recruited; 4 patients of cancer gall bladder were in advanced inoperable stage. In these cases only blood was taken for CCK receptors analysis. Thus, CCK receptors analysis was completed in 45 gall bladder tissue samples.
The mean age of the subjects was 45.12±13.19 years with a significant difference in the ages between cholelithiasis and CA gallbladder groups (p<0.001). The male (n=16) and female (n=33) ratio was 1:2. There was no significant difference in the haematological parameters and coagulation profile among patients and control subjects [Table/Fig-1]. However, significant difference was seen in the total (p=0.025) and conjugated serum bilirubin (p=0.024) levels between cholelithiasis and CA gallbladder groups [Table/Fig-1].
The preoperative ultrasonic findings of the subjects have been described in [Table/Fig-2]. There was significant (p=0.001) difference in the wall thickening between normal and patients of cholelithiasis and CA gallbladder. Intrahepatic biliary radical dilatation was present in one subject each of normal gall bladder and cholelithiasis as against 13 subjects having CA gallbladder (p=0.000) [Table/Fig-2].
The gallbladder tissue samples of all normal subjects and patients of gall bladder CA showed RNA expression whereas only 84.2% (n=16/19) patients in the cholelithiasis group found to have RNA expression. Both types of receptors, CCK-A and CCK-B, were expressed in each subject. It was further observed that there was increased expression of CCK-B receptors in about 2/3rd cases in all groups but the difference did not rise to significance (p= 0.27) [Table/Fig-3].
In blood samples of normal gall bladder subjects RNA expression was seen in all cases. But RNA expression was seen in 78.9% and 86.3% patients of cholelithiasis and CA gall bladder respectively. There was expression for both CCK-A and CCK-B receptors but unlike gall bladder tissue the expression of CCK-A was more (52.6% to 86.6%) in the blood compared to CCK-B receptors though statistically non-significant (p= 0.17) [Table/Fig-4]. Housekeeping gene (β-actin), which acted as control for the test procedure, was expressed in all patients where RNA and CCK receptors expressed. This confirmed the quality of the testing for expression of the CCK receptors.
Discussion
Cholecystokinins are G protein-coupled receptors which are widely distributed in the body. Till now 2 types of CCK receptors, CCK-A and CCK-B, have been well studied. CCK-C, another Cholecystokinin receptor, has also been described recently [13]. Though these receptors are universally present in the body yet most of the studies have been done only on GIT.
In the stomach CCK-B receptors are predominantly expressed in fundic mucosa, corresponding to the location of parietal cells [14-16]. The CCK-A receptors which are present in the gastric muscle cause delay in gastric emptying [16,17]. In pancreas CCK-B receptors are predominantly expressed in exocrine pancreas and cause pancreatic enzyme secretion [18].
CCK receptors in the human gallbladder have been extensively studied. CCK induces gallbladder contraction via activation of CCK-A receptor located on smooth muscle cells [13]. Both in vivo and in vitro binding assays have shown CCK receptors with high affinity in the human gallbladder [9,19]. Impaired gallbladder emptying has been reported in the patients with cholesterol gall stones, resulting from the defect in CCK-A receptor in the gallbladder [20].
Several studies on gallbladder contraction in patients with gallstones in response to direct or indirect stimulation of CCK release, have demonstrated increased or decreased sensitivity to this hormone. Two distinct groups of patients with gallstones have been identified; patients in whom gallbladder motility is depressed; and patients in whom gallbladder motility is unaltered inspite of diminished release of CCK. This suggests that gallbladder sensitivity to circulating CCK is increased in later group of patients suffering from cholelithiasis [21]. A mixture of both subsets of patients of gallstone in various studies may be the reason for differing results.
Von Schrenck et al., [22] reported that only CCK-A receptors were localized in the human gallbladder muscle. Another study showed that CCK-A receptor was more concentrated in human gallbladder though CCK-B receptors were also present [9]. However, we found that both CCK-A and CCK-B receptors were expressed, with overall predominance of CCK-B receptors in healthy as well diseased gallbladder tissue samples. Our observations may be explained by the fact that we studied whole gallbladder wall including mucosa, submucosa, muscle and serosa where spatial expression of CCK-A and CCK-B receptors may differ in different regions.
On comparing predominance of CCK-A receptor expression in the gallbladder tissue irrespective of disease state in our study it was found that, though not significant (p=0.27), there was higher expression of CCK-A receptor (44%) in Cholelithiasis group and decreased expression of CCK-A receptors in CA gallbladder group (27%) as compared to normal group (37%). Recent study showed that young patients suffering from gallbladder cancer has higher expression of CCK-A receptors but further studies on large sample required [23]. Studies show expression of CCK-B receptors in blood mononuclear [24] and polymorphonuclear cells [25]. Unlike gallbladder tissue the expression of CCK receptors in the blood was in favour of CCK-A receptors but pattern was similar; it was more in the patients of cholelithiasis and less in cancer gallbladder in comparison to normal gallbladder tissue. So, no definite conclusion can be made about the expression of CCK-A and CCK-B receptors in different gall bladder diseases. To the best of our understanding not enough studies are available for comparison of results of our study. In fact much is left to be learnt about physiological functions and control and pathological alterations of CCK receptors in normal and diseased gallbladder before any conclusion can be drawn about relative importance of CCK-A and CCK-B receptors in the causation or effect of the disease.
Clinical profile of subjects
| Parameters | Total (n=49) | Normal Gallbladder (n=8) | Cholelithiasis (n=19) | CA Gallbladder (n=22) | p value |
|---|
| Age (years) | 45.12±13.1 | 43.25±15.3 | 37.42±14.5 | 52.43±5.1 | 0.001* |
| Haemoglobin (gm %) | 12.25± 1.7 | 11.92± 1.5 | 12.99± 1.6 | 11.74±1.6 | 0.05 |
| TLC (cell/mm3) | 8185.7± 2363.7 | 8862.5±4330.6 | 7863.1±1692.8 | 8218.1±1947.8 | 0.61 |
| Platelet Count (lacs/mm³ ) | 2.64±0.50 | 2.76± 0.56 | 2.73±0.52 | 2.53±0.47 | 0.73 |
| ESR (mm in 1st hr) | 12.40±5.1 | 15±8.2 | 11.49±5.1 | 12.23±3.4 | 0.27 |
| Bleeding time (min.) | 2.44±0.3 | 2.3±0.2 | 2.5±0.4 | 2.4±0.1 | 0.46 |
| Clotting time(min.) | 5±0.5 | 4.6±0.3 | 5.1±0.5 | 5.1±0.5 | 0.07 |
| Prothrombin time (sec.) | 13.4±0.8 | 13.2±0.7 | 13.2±0.6 | 13.7±0.9 | 0.09 |
| S. Bilirubin (Total) (mg/dl) | 1.33±1.5 | 0.96±0.9 | 0.76±1.2 | 1.96±1.6 | 0.025* |
| S. Bilirubin (Conj.) (mg/dl) | 0.74±0.98 | 0.47±0.6 | 0.38±0.86 | 1.16±1.0 | 0.024* |
| S. SGOT (IU/L) | 91.38±145.6 | 25.96±15.1 | 33.11±23.38 | 165.4±193.5 | 0.004* |
| S. SGPT (IU/L) | 88±121.1 | 42.9±32.7 | 36.22±24.3 | 149.2±159.8 | 0.004* |
| S. Alkaline Phosphatase (IU/L) | 355.4±540.3 | 140.6±71.6 | 240.2±555.3 | 532±582 | 0.1 |
| S. Protein (g/dl) | 6.84±0.5 | 6.99±0.6 | 7.05±0.4 | 6.59±0.5 | 0.017* |
| S. Albumin (g/dl) | 4.05±0.6 | 4.2±0.3 | 4.26±0.6 | 4.26±0.6 | 0.07 |
| S. Creatinine (mg/dl) | 1.13±0.22 | 1.22±0.33 | 1.10±0.22 | 1.12±0.19 | 0.48 |
| B. Urea (mg/dl) | 27.06±8.26 | 33±10.98 | 26.06±8.72 | 25.77±5.86 | 0.08 |
| S. Na+ (mmol/l) | 138.9±2.95 | 139.38±2.13 | 138.95±2.64 | 138.68±3.51 | 0.85 |
| S. K+ (mmol/l) | 3.93±0.38 | 4.02±0.57 | 4.02±0.25 | 3.8±0.38 | 0.13 |
* indicates the values are statistically significant TLC- Total Leucocyte count, Na+- Sodium, K+- Potassium
| Parameters | Normal Gallbladder (n=8) | Cholelithiasis (n=19) | CA Gallbladder (n=22) | p value |
|---|
| Gallbladder wall thickening | 0 | 13 | 16 | 0.001* |
| Gallbladder mass | 0 | 0 | 22 | Constant |
| Intrahepatic biliary radical dilatation | 1 | 1 | 13 | 0.000* |
| Contiguous liver spread | 0 | 0 | 4 | 0.06 |
| Regional lymph node involvement | 1 | 0 | 8 | 0.019* |
| Non-Contiguous liver spread | 0 | 0 | 0 | Constant |
| Ascites/ intraperitoneal collection | 2 | 0 | 2 | 0.11 |
| Single stone | 0 | 3 | 5 | 0.000* |
| Multiple stones | 0 | 16 | 14 |
| No stone | 8 | 0 | 3 |
* indicates the values are statistically significant
Cholecystokinin (CCK) receptors in gallbladder tissue samples
| Subjects | RNA | β-actin | Increased expression of CCK-A Receptors* | Increased expression of CCK-B Receptors* |
|---|
| Normal (n=8) | 8 | 8 | 3 (37.5%) | 5 (62.5%) |
| Gallstone (n=19) | 16 | 16 | 7 (43.7%) | 9 (56.3%) |
| CA gallbladder (n=18)^ | 18 | 18 | 5 (27.7%) | 13 (72.3%) |
p = 0.27; * Both receptors expressed but one was more than other, ^ in four patients gall bladder tissue not obtained as they were inoperable
Cholecystokinin (CCK) receptors in blood sample
| Subjects | RNA | RNA β–actin | Increased expression of CCK A Receptors* | Increased expression of CCK B Receptors* |
|---|
| Normal (n=8) | 8 | 8 | 5 (62.5%) | 3 (37.5%) |
| Gallstone (n=19) | 15 | 15 | 13 (86.6%) | 2 (13.4%) |
| CA gallbladder (n=22) | 19 | 19 | 10 (52.6%) | 9 (47.4%) |
p= 0.17; * Both receptors expressed but one was more than other
limitation
The limitation of our study was that besides being a preliminary study on examining the expression of cholecystokinin receptors in the gallbladder tissue and blood in diseased gallbladder, the small sample size and inability to study other parameters like genetic makeup, different food habits, and racial differences in these subjects further compromised scope of the work.
Conclusion
Our study showed that both CCK-A and CCK-B receptors were expressed in the gallbladder tissue and blood of patients with normal gallbladder, and gallbladder with cholelithiasis and CA. There was higher expression of CCK-A receptors in patients of cholelithiasis and decreased expression of CCK-A receptors in patients of CA gallbladder as compared to normal gallbladder although it did not rise to statistical significance.
* indicates the values are statistically significant TLC- Total Leucocyte count, Na+- Sodium, K+- Potassium* indicates the values are statistically significantp = 0.27; * Both receptors expressed but one was more than other, ^ in four patients gall bladder tissue not obtained as they were inoperablep= 0.17; * Both receptors expressed but one was more than other
[1]. JM Piehler, RW Crichlow, Primary CA of the gallbladder Surg. Gynecol Obstet 1978 147(6):929-42. [Google Scholar]
[2]. MO Perpeuro, M Valdivieso, LK Heilbrun, Natural history of gallbladder cancer: a review of 36 years’ experience at M.D. Anderson hospital and tumour institute. Cancer. 1978 42(330) [Google Scholar]
[3]. EC Lazcano-Ponce, JF Miquel, N Munoz, Epidemiology and molecular pathology of gallbladder cancer. CA Cancer J Clinic 2001 51(6):349 [Google Scholar]
[4]. VK Shukla, C Khandelwal, SK Roy, Primary CA of the gallbladder: A review of a 16-year period at the university hospital Jour Surg Oncol 1985 28:32-5. [Google Scholar]
[5]. VK Kapoor, AJ McMichael, Gallbladder cancer: an ‘Indian’ disease Natl Med J India 2003 16(4):209-13. [Google Scholar]
[6]. S Mishra, A Chaturvedi, NC Misra, CA of the gallbladder Lancet Oncol 2003 4:167-76. [Google Scholar]
[7]. SN Pandey, M Jain, P Nigam, Genetic polymorphisms in GSTM1, GSTT1, GSTP1, GSTM3 and the susceptibility to gallbladder cancer in North India. Biomarkers. 2006 11:250-61. [Google Scholar]
[8]. YS Guo, XL Rui, CM Townsend, Glycine extended gastrin activation of CCK B receptors can stimulate proliferation of rat intestinal epithelial cells. Abstract presented in Jour Cancer 1998 34:1455-59. [Google Scholar]
[9]. S Wank, Cholecystokinin receptors 1995 269:628-46. [Google Scholar]
[10]. KK Mandair, P Towner, IF Stamford, Cholecystokinin receptors in human pancreatic cancer cell lines. Eur Jour Cancer 1998 34:1455-59. [Google Scholar]
[11]. A Srivastava, SN Pandey, M Dixit, G Choudhuri, B Mittal, Cholecystokinin receptor A gene polymorphism in gallstone disease and gallbladder cancer Journal of Gastroenterology and Hepatology 2008 23:970-75. [Google Scholar]
[12]. RW Steigerwalt, ID Goldfine, JA Williams, Characterization of Cholecystokinin receptors on bovine gallbladder membranes. Am J Physiol Gastrointest Liver Physiol 1984 247:G709-14. [Google Scholar]
[13]. A De Weerth, JR Pisegna, K Huppi, Molecular cloning, functional expression and chromosomal localisation of the human cholecystokinin type A receptor Biochem Biophys Res Commun 1993 194:811-18. [Google Scholar]
[14]. JR Pisegna, A De Weerth, K Huppi, Molecular cloning of the human brain and gastric cholecystokinin receptor: structure, functional expression and chromosomal localisation Biochem Biophys Res Commun 1992 189:296-303. [Google Scholar]
[15]. JP Smith, MF Verderame, P McLaughlin, Characterisation of the CCK-C (cancer) receptor in human pancreatic cancer Int J Mol Med 2002 10:689-94. [Google Scholar]
[16]. E Lindstrom, D Chen, P Norlen, Control of gastric acid secretion: the gastrin-ECL cell-parietal cell axis Comp Biochem Physiol A Mol Integr Physiol 2001 128:505-14. [Google Scholar]
[17]. C Prinz, R Zanner, M Gratzl, Physiology of gastric enterochromaffin-like cells Annu Rev Physiol 2003 65:371-82. [Google Scholar]
[18]. HL Waldum, PM Kleveland, AK Sandvik, The cellular localization of the cholecystokinin 2 (gastrin) receptor in the stomach Pharmacol Toxicol 2002 91:359-62. [Google Scholar]
[19]. Y Tokunaga, KL Cox, R Coleman, Characterization of Cholecystokinin receptors of the human gallbladder Surgery. 1993 113:155-62. [Google Scholar]
[20]. J Zhu, TQ Han, S Chen, Gallbladder motor function, plasma cholecystokinin, and Cholecystokinin receptor of gallbladder in cholesterol stone patients World J Gastroenterol 2005 11:1685-89. [Google Scholar]
[21]. JR Upp, WH Nealon, P Singh, Correlation of cholecystokinin receptors with gallbladder contractility in-patients with gallstones Ann Surg 1987 205(6):641-48. [Google Scholar]
[22]. T Von Schrenck, M Ahrens, A de Weerth, CCKB/gastrin receptor mediate changes in sodium and potassium absorption in the isolated perfused rat kidney. Kidney Int 2000 58:995-1003. [Google Scholar]
[23]. HR Kazmi, A Chandra, K Baghel, Differential Expression of Cholecystokinin A Receptor in Gallbladder Cancer in the Young and Elderly Suggests Two Subsets of the Same Disease? BioMed Research International 2014 2014(625695.) [Google Scholar]
[24]. F Schmitz, H Schrader, J Otte, Identification of CCK-B/gastrin receptor splice variants in human peripheral blood mononuclear cells Regul Pept 2001 101:25-33. [Google Scholar]
[25]. N Iwata, T Murayama, Y Matsumori, Autocrine loop through cholecystokinin-B/gastrin receptors involved in growth of human leukemia cells Blood. 1996 88:2683-89. [Google Scholar]