JCDR - Register at Journal of Clinical and Diagnostic Research
Journal of Clinical and Diagnostic Research, ISSN - 0973 - 709X
Microbiology Section DOI : 10.7860/JCDR/2015/12090.5990
Year : 2015 | Month : May | Volume : 9 | Issue : 5 PDF Full Version Page : DC11 - DC14

Prevalence of Enterotoxin Genes and spa Genotypes of Methicillin-resistant Staphylococcus aureus from a Tertiary Care Hospital in China

Yanmeng Li1, Ruike Zhao2, Xianfeng Zhang3, Qingzhen Han4, Xuefeng Qian5, Guohao Gu6, Jinfang Shi7, Jie Xu8

1 Faculty, Department of Clinical Laboratory, the First Affiliated Hospital of Soochow University, Suzhou, P.R. of China.
2 Faculty, Department of Clinical Laboratory, the First Affiliated Hospital of Soochow University, Suzhou, P.R. of China.
3 Faculty, Department of Clinical Laboratory, the First Affiliated Hospital of Soochow University, Suzhou, P.R. of China.
4 Faculty, Department of Clinical Laboratory, the First Affiliated Hospital of Soochow University, Suzhou, P.R. of China.
5 Faculty, Department of Clinical Laboratory, the First Affiliated Hospital of Soochow University, Suzhou, P.R. of China.
6 Faculty, Department of Clinical Laboratory, the First Affiliated Hospital of Soochow University, Suzhou, P.R. of China.
7 Faculty, Department of Clinical Laboratory, the First Affiliated Hospital of Soochow University, Suzhou,P.R. of China.
8 Faculty, Department of Clinical Laboratory, the First Affiliated Hospital of Soochow University, Suzhou,P.R. of China.


NAME, ADDRESS, E-MAIL ID OF THE CORRESPONDING AUTHOR: Dr. Jie Xu, Faculty, Department of Clinical Laboratory, the First Affiliated Hospital of Soochow University, No. 188, Shizijie, Canglang District, Suzhou, 215006, P.R. China. E-mail : xuj2007@lzu.edu.cn
Abstract

Objectives

Methicillin-resistant Staphylococcus aureus (MRSA) is a major nosocomial pathogen that causes a variety of infections. MRSA has evolved resistance to multiple antibiotics. Genetic background and virulence differs in different geographic regions. The present study was aimed to investigate the prevalence of enterotoxin genes and spa genotypes of hospital-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) isolated from a tertiary care hospital of Jiangsu province, China.

Materials and Methods

HA-MRSA isolates from August 2013 to April 2014 at a tertiary care hospital of China were collected. We investigated antimicrobial pattern, spa types, SCCmec types and the presence of 14 virulence genes.

Results

Eighty HA-MRSA isolates were collected. Results from SCCmec typing revealed that 73.8% were type II; 13.8% were type III; 12.5% were type V. There were 19 different spa types. Spa type t2460 was the most common (35.0%), followed by t002 (11.3%). CC5 was the predominant MLST CCs type (50%). The most frequent toxin genes were sea, seb, sed, sel, sen and seo (100.0%). None of the investigated isolates carried the sec or tst.

Conclusion

Genotypic and virulence evaluation of the isolated HA-MRSA revealed that the isolates with CC5 and SCCmec II were the predominant type and highly homological. The virulence profiles mainly existed in the genes of sea, seb, sed, sel, sen, seo and ser. The prevalence of t2460 was an outbreak and the predominant spa type.

Keywords

sea, seb, sed, sel, sen, seo, ser, t2460

Introduction

Methicillin-resistant Staphylococcus aureus (MRSA) is a pathogen of public health importance. Since the first European isolate of MRSA was detected in 1961, MRSA isolates has become a leading cause of hospital-acquired or healthcare-associated infections throughout the world [13]. In China, the mean prevalence rate of HA-MRSA isolates had reached 47.9 % by 2012 [4]. MRSA strains have acquired and integrated into their genome a 21-67 kb mobile genetic element, termed the staphylococcal cassette chromosome mec (SCCmec). SCCmec elements are highly diverse in their structural organization and genetic content and have been classified into types and subtypes. Strains with SCCmec types I, II and III are most commonly found in isolates from hospital-acquired infections, while community-acquired strains predominantly carry SCCmec types IV or V [5,6]. SCCmec type IV is also characteristic of some HA-MRSA clones. Spa typing based on the polymorphic staphylococcal protein A(spa) coding region is a common genotyping tool for MRSA [7]. Genotyping with spa has been showed discriminatory power similar to multi-locus sequence typing (MLST) [8].

Enterotoxins, toxic shock syndrome toxin 1(TSST-1), exfoliative toxin (ET), haemolysins and coagulase are among various virulence factors produced by S. aureus. The enterotoxins, and TSST-1, belong to a family of superantigens. Eighteen Staphylococcal enterotoxins (SEs) have been recognized as: SEA, SEB, SEC, SED, SEE, SEG, SEH, SEI, SEJ, SEK, SEL, SEM, SEN, SEO, SEP, SEQ, SER and SEU. They are the main source of food poisoning and cause intensive intestinal peristalsis [9]. The present study aimed to identify the types of spa, SCCmec and the virulence genes among HA-MRSA isolates collected from a tertiary care hospital. Their association was examined to enhance our current knowledge of the pathogenicity and evolution of HA-MRSA.

Materials and Methods

Selection of the strains

Eighty HA-MRSA strains were isolated from unrelated patients in the First Affiliated Hospital of Soochow University from September 2013 to June 2014. This hospital has 1800 beds and serves a population of 1,000, 000 inhabitants in both urban and rural areas. These strains were obtained from sputum (71), wound swabs (9), secretions (3), Pharyngeal swabs (3), urine samples (3), body fluid (2), liquor puris (2), bone marrow (1), catheter (1) and others (1). The presence of methicillin resistance was evaluated using a cefoxitin disc (30μg; Oxoid). The presence of the resistance gene mecA was tested for PCR according to a protocol previously described [10].

Susceptibility testing

Antimicrobial susceptibility test for isolates of S. aureus was performed against cefoxitin (FOX, 30μg), penicillin (P, 10μg), ciprofloxacin (CIP, 5μg), clindamycin (DA, 30μg), sulfamethoxazole (SXT, 25μg), vancomycin (VAN, 30μg), teicoplanin (TEC, 30μg) and linezolide (LZD, 30μg) (Oxoid, UK), by the disc diffusion method. The results were interpreted according to the Clinical and Laboratory Standards Institute guidelines (CLSI- 2011) [11].

DNA isolation

All isolates were cultured on blood agar and incubated overnight at 370C. Genomic DNA was isolated from all strains with Wizard Genomic DNA purification kit (Promega, China), according to the manufacturer’s instructions and used as template for PCR.

Spa typing of strains

All HA-MRSA were characterized by comparative DNA analysis of the variable number of tandem repeats region of the S. aureus protein A (spa) gene similar to a previously described method [12], using primers spa-1095F and spa-1517R. Calculation of the type ability, diversity, and concordance of the spa typing method with the results of alternative typing methods was implemented in Ridom SpaServer software (http://spa.ridom.de/index.shtml).

SCCmec typing of strains

MRSA strains were further characterized by simplex PCR of the SCCmec gene, as described elsewhere [13].

Detection of virulence genes

The genes encoding staphylococcal enterotoxins (sea, seb, sec, sed, selR, sen, seo, sep, seq, ser, seu), tst-1, pvl and cna were performed by single PCR as previously reported [14]. The primers used in this study are listed in [Table/Fig-1].

Primers used for amplification of spa, SCCmec and Virulence genes

PrimersOligonucleotide sequence (5’–3’)Sizes (bp)SpecificityReference
Type I -FGCTTTAAAGAGTGTCGTTACAGG613SCCmec I[13]
Type I-RGTTCTCTCATAGTATGACGTCC
Type II-FCGTTGAAGATGATGAAGCG398SCCmec II[13]
Type II-RCGAAATCAATGGTTAATGGACC
Type III-FCCATATTGTGTACGATGCG280SCCmec III[13]
Type III-RCCTTAGTTGTCGTAACAGATCG
Type IVa-FGCCTTATTCGAAGAAACCG776SCCmec IVa[13]
Type IVa-RCTACTCTTCTGAAAAGCGTCG
Type IVb-FTCTGGAATTACTTCAGCTGC493SCCmec IVb[13]
Type IVb-RAAACAATATTGCTCTCCCTC
Type IVc-FACAATATTTGTATTATCGGAGAGC200SCCmec IVc[13]
Type IVc-RTTGGTATGAGGTATTGCTGG
Type IVd-FCTCAAAATACGGACCCCAATACA881SCCmec IVd[13]
Type IVd-RTGCTCCAGTAATTGCTAAAG
Type V-FGAACATTGTTACTTAAATGAGCG325SCCmec V[13]
Type V-RTGAAAGTTGTACCCTTGACACC
1095FAGACGATCCTTCGGTGAGCspa typing[13]
1517RGCTTTTGCAATGTCATTTACTG
pvl-FATCATTAGGTAAAATGTCTG GACATGATCCA433pvl[14]
pvl-RGCATCAASTGTATTGGATA GCAAAAGC
tst-FACCCCTGTTCCCTTATCATC326tst[14]
tst-RTTTTCAGTATTTGTAACGCC
cna-FGTCAAGCAGTTATTAACA CCAGAC423cna[15]
cna-RAATCAGTAATTGCACTTTG TCCACTG
sea-FGGTTATCAATGTGCGGGTGG102sea[10]
sea-RCGGCACTTTTTTCTCTTCGG
seb-FGTATGGTGGTGTAACTGAGC164seb[10]
seb-RCCAAATAGTGACGAGTTAGG
sec-FAGGTTTTTTCACAGGTCATCC209sec[10]
sec-RCTTTTTTTTCTTCGGTCAATC
sed-FCCAATAATAGGAGAAAATAAAAG278sed[10]
sed-RATTGGTATTTTTTTTCGTTC
selR-FGGATAAAGCGGTAATAGCAG166selR[16]
selR-RGTATTCCAAACACATCTAAC
sen-FCTTCTTGTTGGACACCATCTT135sen[17]
sen-RGAAATAAATGTGTAGGCTT
seo-FAAATTCAGCAGATATTCCAT172seo[17]
seo-RTTTGTGTAAGAAGTCAAGTGTAG
sep-FATCATAACCAACCGAATCAC148sep[17]
sep-RAGAAGTAACTGTTCAGGAGCTA
seq-FTCAGGTCTTTGTAATACAAAA359seq[17]
seq-RTCTGCTTGACCAGTTCCGGT
ser-FAGATGTGTTTGGAATACCCTAT123ser[17]
ser-RCTATCAGCTGTGGAGTGCAT
seu-FATTTGCTTTTATCTTCAT167seu[17]
seu-RGGACTTTAATGTTTGTTTCTGAT
mecA-FACTGCTATCCACCCTCAAAC147mecA[10]
mecA-RCTGGTGAAGTTGTAATCTGG

Results

Antimicrobial Susceptibility

Overall, the resistance rates for the HA-MRSA strains were 100.0% (80/80) for cefoxitin (FOX), 100% (80/80) for penicillin (P), 93.8% (75/80) for ciprofloxacin (CIP), 62.5% (50/80) for clindamycin (DA), 13.8% (11/80) for sulfamethoxazole (SXT) [Table/Fig-2]. NO resistance to vancomycin, teicoplanin, and linezolide was found. Almost all of the isolates except four which were included in this study, were found to be resistant to three or more groups of antibiotics which were tested and five different resistant patterns were observed amongst them [Table/Fig-3]. Most strains were resistant to cefoxitin, penicillin and ciprofloxacin.

Drug resistance of the 80 HA-MRSA isolates

AntibioticsResistant (%)
FOX80(100%)
P80(100%)
CIP75(93.8%)
DA50(62.5%)
SXT11(13.8%)
VAN0
TEC0
LZD0

Resistance patterns of the MRSA isolates

Resistance patternNo. of isolates
FOX-P-CIP-DA-SXT9
FOX-P-CIP-DA40
FOX-P-CIP-SXT2
FOX-P-CIP24
FOX-P-DA1
FOX-P4

SCCmec typing and spa typing

The distribution of SCCmec types, spa types, virulence gene profile in isolates is shown in [Table/Fig-4]. Among the 80 HA-MRSA strains, SCCmec II, SCCmec III and SCCmec V were identified in 73.8%(59/80), 13.8%(11/80) and 12.5%(10/80) of strains, respectively.

The SCCmec type, spa type, and virulence genes profile of the 80 HA-MRSA isolates

Spa typesCCsSCC mecNo. of positive strains
seasebsecsedselsenseosepseqserseucnapvltst
t2460(28)5II2828028282828122426220
t002(9)5II99099990099110
t632(7)-II77077772271700
t030(6)8II66066660541200
t437(3)59II33033331220020
t211(2)8II22022220020100
t4549(2)-II22022220121000
t299(1)-II11011110011000
t189(1)-II11011111011000
t311(3)5V33033330233100
t163(2)-V22022220212200
t2310(2)-V22022222021000
t164(2)-V22022220022100
t377(1)-V11011111011000
t037(5)8III55055550032110
t264(2)-III22022220021100
t279(2)-III22022220021000
t459(1)-III11011110111100
t034(1)-III11011110011100
Total(80)80 (100.0%)80 (100.0%)080 (100.0%)80 (100.0%)80 (100.0%)80 (100.0%)8 (10.0%)17 (21.3%)74 (92.5)54 (67.5%)21 (26.2%)6 (7.5%)0

There were 19 different spa types (t2460, t002, t632, t030, t437, t211, t4549, t299, t189, t311, t163, t2310, t164, t377, t037, t264, t279, t459 and t034) [Table/Fig-4]. Spa type t2460 were the most prevalent one (35.0%, 28/80), followed by spa type t002 (11.3%, 9/80). The prevalence of t2460 was thought to be an outbreak. It was previously reported that t002, t311, and t2460 were linked to MLST CC5, and t030, t211 and t037 were associated with CC8 [18,19]. CC5 is one of the major MLST CCs type (50%, 40/80) in Suzhou.

Virulence factors genes analysis

The presence of 14 virulence genes was in all 80 HA-MRSA isolates. The most frequent toxin genes were sea, seb, sed, sel, sen and seo (100.0%, 80/80), followed by ser (92.5 %, 74/80), seu (67.5%, 54/80), cna (26.2%, 21/80), seq (21.3%, 17/80), sep (10.0%, 8/80) and pvl (7.5%, 6/80) [Table/Fig-4]. But none of the investigated isolates carried the sec or tst.

The enterotoxin gene cluster is always present in MLST CC5, CC22, and CC45 strains but not in CC8, CC12, CC15, and CC395 [20]. The results that CC5 is the major MLST CC type (50%) showed that distribution of the virulence gene cluster in our study is similar to that of previous findings.

Discussion

Virulence and resistance are two important pathogenic character-istics. Strains with different virulence factors commonly display different level of pathogenicity. Genetic background and virulence differs in different geographic regions. This study was conducted to investigate the virulence characteristics and the presence of virulent genes in HA-MRSA from China. Wu et al., reported that the SAg genes presence of exfoliative toxin genes in CA-MRSA isolates collected from Chinese children [21]. The common toxin gene combination was seb-sek-seq, with 92.6% found in CC59 [21]. Our results displayed that the most common toxin gene combination was sea-seb-sed-sel-sen-seo-ser (100.0%, 80/80), with 50% found in MLST CC5. Previous study showed that SEA and SEC tend to trigger T-cell proliferation and induce higher inflammatory responses resulting in host tissue damage than do other enterotoxins [18]. In this study, we did not find the existence of sec in Suzhou isolates. Similar results were also observed in a previous study [22]. This implied that the virulence characteristics between HA-MRSA and CA-MRSA were different and there may be different evolutionary mechanism underling this. Further investigation is required.

Researches based on spa typing exhibited that the predominant HA-MRSA clone was t2460-MRSA in Asian countries besides Japan and South Korea (MLST CC5) [23,24]. Our study displayed the same results among the 80 HA-MRSA isolates (35.0%, 28/80). Shipeng Li et al., [25] and Yanghong Qiao et al., [26] reported that the predominant spa-type in MRSA isolated from Chinese children was t437. MRSA isolated from children may be community acquired MRSA (CA-MRSA). Hang Cheng et al., [27] found that the prevalent spa-type was t030. However, only three strains were spa-type t437 and six strains were spa-type t030 in the study. This implied that the prevalent spa types between HA-MRSA and CA-MRSA may be different. It was previously reported that t002, t601, and t2460 are linked to MLST CC5, and t037 is associated with CC8 [25]. In the study, the CC5 isolates accounted for 50% (40/80) of the representative strains [Table/Fig-4]. [Table/Fig-4] showed that t2460(35%, 28/80), t002(11.3%, 9/80), t632(8.8%, 7/80) and t030(7.5%, 6/80) were the common spa types in Suzhou isolates. It was previously reported that the genetic background is closely related to virulence factors [28]. The enterotoxin gene cluster is always present in MLST CC5, CC22, and CC45 strains but not in CC8, CC12, CC15, and CC395 [17]. Our study displayed CC5 was the major MLST CC type (50%). Therefore, the distribution of the virulence gene cluster in our study is similar to that of previous findings.

Conclusion

In summary, Genotypic and virulence evaluation of the HA-MRSA revealed that the isolates with CC5 and SCCmec II were the predominant type and highly homological. The virulence profiles mainly existed in the genes of sea, seb, sed, sel, sen, seo and ser. The prevalence of t2460 was an outbreak and the predominant spa type. The prevalence of enterotoxin genes and spa genotypes of HA-MRSA explored in this study enhance our current knowledge of the pathogenicity and genetic characteristics of MRSA. Moreover, investigating the prevalence of enterotoxin genes and spa genotypes of HA-MRSA is crucial for infection control and appropriate therapy.

Financial or Other Competing Interests

None.

References

[1]Johnson AP, Aucken HM, Cavendish S, Ganner M, Wale MC, Warner M, Dominance of EMRSA-15 and-16 among MRSA causing nosocomial bacteraemia in the UK: analysis of isolates from the European Antimicrobial Resistance Surveillance System (EARSS)J Antimicrob Chaemother 2001 48(1):143-44.  [Google Scholar]

[2]Oliveira GA, Faria JB, Levyand CE, Mamizuka EM, Characterization of the Brazilian endemic clone of methicillin-resistant Staphylococcus aureus (MRSA) from hospitals throughout BrazilBrazilian Braz J Infect Dis 2001 5(4):163-70.  [Google Scholar]

[3]Stefani S, Varaldo P, Epidemiology of methicillin resistant staphylococci in EuropeClin Microbiol Infec 2003 9(12):1179-86.  [Google Scholar]

[4]Wang F, Zhu D, Hu F, Jiang X, Hu Z, 2012 CHINET surveillance of bacterial resistance in ChinaChin J Infect Chaemother 2013 13(05):321-30.  [Google Scholar]

[5]Kluytmans-Vandenbergh MF, Kluytmans JA, Community-acquired methicillin-resistant Staphylococcus aureus: current perspectivesClin Microbiol Infec 2006 12(Suppl 1):9-15.  [Google Scholar]

[6]Ito T, Okuma K, Ma XX, Yuzawa H, Hiramatsu K, Insights on antibiotic resistance of Staphylococcus aureus from its whole genome: genomic island SCCDrug Resist Update 2003 6(1):41-52.  [Google Scholar]

[7]Frenay HM, Bunschoten AE, Schouls LM, van Leeuwen WJ, Vandenbroucke-Grauls CM, Verhoef J, Molecular typing of methicillin-resistant Staphylococcus aureus on the basis of protein A gene polymorphism. European journal of clinical microbiology & infectious diseases : official publication of theEuropean Society of Clinical Microbiology 1996 15(1):60-64.  [Google Scholar]

[8]Nübel U, Strommenger B, Layer F, Witte W, From types to trees: reconstructing the spatial spread of Staphylococcus aureus based on DNA variationInternational Journal of Medical Microbiology 2011 301(8):614-18.  [Google Scholar]

[9]Udo EE, Al-Mufti S, Albert MJ, The prevalence of antimicrobial resistance and carriage of virulence genes in Staphylococcus aureus isolated from food handlers in Kuwait City restaurantsBMC research notes 2009 2(1):108  [Google Scholar]

[10]Mehrotra M, Wang G, Johnson WM, Multiplex PCR for Detection of Genes for Staphylococcus aureus Enterotoxins, Exfoliative Toxins, Toxic Shock Syndrome Toxin 1, and Methicillin ResistanceJ Clin Microbiol 2000 38(3):1032-35.  [Google Scholar]

[11]Cockerill FR, Performance standards for antimicrobial susceptibility testing: twenty-first informational supplementClinical and Laboratory Standards Institute (CLSI) 2011 :68-86.  [Google Scholar]

[12]Harmsen D, Claus H, Witte W, Rothgänger J, Claus H, Turnwald D, Typing of methicillin-resistant Staphylococcus aureus in a university hospital setting by using novel software for spa repeat determination and database managementJ Clin Microbiol 2003 41(12):5442-48.  [Google Scholar]

[13]Zhang K, McClure JA, Elsayed S, Louie T, Conly JM, Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureusJ Clin Microbiol 2005 43(10):5026-33.  [Google Scholar]

[14]Sapri HF, Sani NA, Neoh HM, Hussin S, Epidemiological Study on Staphylococcus aureus Isolates Reveals Inverse Relationship between Antibiotic Resistance and Virulence RepertoireIndian J Microbiol 2013 53(3):321-22.  [Google Scholar]

[15]Tristan A, Ying L, Bes M, Etienne J, Vandenesch F, Lina G, Use of multiplex PCR to identify Staphylococcus aureus adhesins involved in human hematogenous infectionsJ Clin Microbiol 2003 41(9):4465-67.  [Google Scholar]

[16]Omoe K, Hu DL, Takahashi-Omoe H, Nakane A, Shinagawa K, Comprehensive analysis of classical and newly described staphylococcal superantigenic toxin genes in Staphylococcus aureus isolatesFEMS Microbiol Lett 2005 246(2):191-98.  [Google Scholar]

[17]Chiang YC, Liao WW, Fan CM, Pai WY, Chiou CS, Tsen HY, PCR detection of Staphylococcal enterotoxins (SEs) N, O, P, Q, R, U, and survey of SE types in Staphylococcus aureus isolates from food-poisoning cases in TaiwanInt J Food Microbiol 2008 121(1):66-73.  [Google Scholar]

[18]Hu DL, Omoe K, Inoue F, Kasai T, Yasujima M, Shinagawa K, Comparative prevalence of superantigenic toxin genes in meticillin-resistant and meticillin-susceptible Staphylococcus aureus isolatesJ. Med. Microbiol 2008 57(Pt 9):1106-12.  [Google Scholar]

[19]Deurenberg RH, Stobberingh EE, The evolution of Staphylococcus aureusInfect Genet Evol 2008 8(6):747-63.  [Google Scholar]

[20]Holtfreter S, Grumann D, Schmudde M, Nguyen HT, Eichler P, Strommenger B, Clonal distribution of superantigen genes in clinical Staphylococcus aureus isolatesJ Clin Microbiol 2007 45(8):2669-80.  [Google Scholar]

[21]Wu D, Li X, Yang Y, Zheng Y, Wang C, Deng L, Superantigen gene profiles and presence of exfoliative toxin genes in community-acquired meticillin-resistant Staphylococcus aureus isolated from Chinese childrenJ Med Microbiol 2011 60:Pt-1.:35-45.  [Google Scholar]

[22]Liu Q, Han L, Li B, Sun J, Ni Y, Virulence characteristic and MLST-agr genetic background of high-level mupirocin-resistant, MRSA isolates from Shanghai and Wenzhou, ChinaPloS one 2012 7(5):e37005  [Google Scholar]

[23]Kim T, Yi J, Hong KH, Park J-S, Kim E-C, Distribution of virulence genes in spa types of methicillin-resistant Staphylococcus aureus isolated from patients in intensive care unitsKorean J Lab Med 2011 31(1):30-36.  [Google Scholar]

[24]Kwak YG, Truong-Bolduc QC, Bin Kim H, Song KH, Kim ES, Hooper DC, Association of norB overexpression and fluoroquinolone resistance in clinical isolates of Staphylococcus aureus from KoreaJ Antimicrob Chaemother 2013 68(12):2766-72.  [Google Scholar]

[25]Li S, Sun J, Zhang J, Li X, Tao X, Wang L, Comparative analysis of the virulence characteristics of epidemic methicillin–resistant Staphylococcus aureus (MRSA) strains isolated from Chinese children: ST59 MRSA highly expresses core gene–encoded toxinAPMIS 2014 122(2):101-14.  [Google Scholar]

[26]Qiao Y, Ning X, Chen Q, Zhao R, Song W, Zheng Y, Clinical and molecular characteristics of invasive community-acquired Staphylococcus aureus infections in Chinese childrenBMC Infect Dis 2014 14(1):582  [Google Scholar]

[27]Cheng H, Yuan W, Zeng F, Hu Q, Shang W, Tang D, Molecular and phenotypic evidence for the spread of three major methicillin-resistant Staphylococcus aureus clones associated with two characteristic antimicrobial resistance profiles in ChinaJ Antimicrob Chaemother 2013 68(11):2453-57.  [Google Scholar]

[28]De Sousa MA, Conceicao T, Simas C, De Lencastre H, Comparison of genetic backgrounds of methicillin-resistant and-susceptible Staphylococcus aureus isolates from Portuguese hospitals and the communityJ Clin Microbiol 2005 43(10):5150-57.  [Google Scholar]