This retrospective study was conducted in the Department of Microbiology, Sher-i-Kashmir Institute of Medical Sciences, Srinagar, Jammu and Kashmir, India for a period of three months from 1^st May-31^st July 2020 with the preliminary aim to screen isolates of S. aureus for the presence of mecC gene. The demographic data from July 2018-December 2019 was retrieved from the medical records section of the hospital whereas the microbiological data was taken from the patient registers maintained in the laboratory. The study did not involve any patients and hence under Helsinki guidelines was exempted from ethical clearance.

S.aureus isolates were preserved as a matter of routine and were revived by inoculating into nutrient broth which was incubated overnight. These were then subcultured onto blood and nutrient agar the next day. Out of a total of 182 isolates only 102 grew and were included in the study. The samples from which these isolates had been recovered initially included blood, pus and other body fluids and respiratory samples like sputum and Bronchoalveolar Lavage (BAL) fluid. The colonies on blood and nutrient agar were identified as S.aureus by their characteristic morphology, gram staining, catalase and tube coagulase test [12].

Susceptibility test of the isolates was done on Muller Hinton agar by Kirby Bauer disc diffusion method. Antibiotics used were penicillin G, vancomycin, linezolid, erythromycin, clindamycin, cotrimoxazole, ciprofloxacin, cefoxitin (as a surrogate marker for methicillin resistance) and amikacin. Minimum Inhibitory Concentration (MICs) for vancomycin were noted from Vitek-2. The zones of inhibition were measured and the results interpreted according to the guidelines of Clinical Laboratory Standard Institute (CLSI) 2020 [13].

Isolates resistant to cefoxitin were presumptively identified as MRSA and further confirmed by PCR amplification of mecA and/or mecC genes.

A total of 102 retrospective laboratory confirmed isolates of MRSA, were subjected to screening for the presence of mecA and mecC gene by PCR [11,14].

DNA extraction: An in-house method of extraction of nucleic acid combined with spin-column extraction and purification method was used. In brief, 200 μL overnight Brain Heart Infusion (BHI) broth culture of S. aureus was transferred to 1.5 mL Eppendorf tubes and boiled in a water bath for 15 minutes. The samples were immediately chilled in ice for five minutes and subjected to high speed centrifuge at 10,000 × g for five minutes. For removal of protein contamination and purification of the bacterial DNA, the chilled lysates were again extracted with a commercial nucleic acid extraction kit in an automated nucleic acid extraction system (QIAcube HT system, QIAGEN, GmBH, Germany) as per manufacture’s protocol.

Amplification of mecA: Amplification of mecA was performed using forward primer sequence mecA-FP- AAAATCGATGGTAAAGGTTGGC and reverse primer sequence mecA-RP- AGTTCTGCAGTACCGGATTTGC, as described by Merlino J et al., [14]. PCR was performed as per the protocol described with minor modification with the following thermal cycling conditions: Initial denaturation at 95°C for 5 minutes followed by 35 cycles of amplification at 95°C for 30 seconds, 52°C for 60 seconds, 72°C for 60 seconds and final extension at 72°C for 10 minutes. PCR was performed in a total reaction volume of 25 μL using 2x PCR master mix (Promega, Madison, USA), 5 μL of template and 1 μL (0.4 μM final concentration) each of reverse and forward primers. PCR amplified a 533 bp fragment of the mecA specific for the PBP2 or PBP2a.

Amplification of mecC: For mecC, PCR amplification was performed using forward primer sequence mecC-FP- GAAAAAAAGGCTTAGAACGCCTC and reverse primer sequence mecC-RP- GAAGATCTTTTCCGTTTTCAGC as described previously [11]. PCR was performed in 25 μL using 5 μL of extracted DNA template, 2x PCR master mix, 1 μL of each forward and reverse primers (0.4 μM) with thermal cycling profile of initial denaturation at 95°C for 5 minutes followed by 35 cycles of amplification at 95°C for 30 seconds, 59°C for 60 seconds, 72°C for 60 seconds and final extension at 72°C for 10 minutes. PCR amplified a specific 138 bp fragment of mecC gene.

Control strains of S.aureus American Type Culture Collection (ATCC) 43300 for mecA positive and ATCC 25923 for mecA negative were used for quality control of all tests. Both mecA and mecC PCR amplified products were electrophoresed using 2% agarose gel in a horizontal electrophoresis system and visualised in a gel documentation imager (myECL imager, ThermoFisher Scientific, Waltham, USA).

Hospital record files for the 102 isolates were screened and parameters like age, gender, diagnosis at the time of admission, sample submitted, antibiotics received, duration of hospital stay and outcome in terms of death or discharge from the hospital were noted.

Statistical analysis was done using SPSS software v24.0. The data was shown in the form of frequency and percentage.

A total of 102 laboratory confirmed clinical isolates of MRSA that could be revived were a part of the present study. Demographic parameters, diagnosis at the time of hospital admission, duration of hospital stay, antibiotics received and outcome of the patients from whose samples MRSA were recovered is shown in [Table/Fig-1]. Out of these isolates of MRSA, mecA gene was found in 98 (96.1%) isolates whereas, mecC gene was found in 4 (3.9%) isolates as confirmed by PCR [Table/Fig-2].

[Table/Fig-2]:

PCR confirmation of S. aureus isolates carrying the mecA and mecC genes. Lane 3, 4 and 6 are the mecC positive isolates (133bp) and lanes 12, 13, 15, 17 are representative mecA positive isolates (533bp). Lane 9 represents the 100 bp ladder, Lane 8 carries the positive control for mecC and Lane 10 carries the positive control of mecA. Lane 11 is negative control.

Two of the four mecC positive MRSA isolates were recovered from wound swabs that belonged to burn patients and one isolate was recovered from endotracheal tip of a patient of road traffic accident admitted in the Surgical Intensive Care Unit (SICU) of the hospital whereas one isolate was recovered from pus sample of a patient of chronic renal failure undergoing peritoneal dialysis. Samples from which MRSA isolates were recovered are shown in [Table/Fig-3]. All the mecC carrying MRSA were recovered from male patients in the age group of 30-49 years. Chronic renal failure patient (47-year-old male) was on peritoneal dialysis from the last five years and was suffering from hypertension and Type II diabetes mellitus. Rest of the patients did not have any co-morbidities. Road traffic accident patient was a 34-year-old male who was admitted in the SICU after undergoing surgery for his head injury. The other two patients were 39 and 42-year-old males with burn injuries to the face and chest and left thigh respectively.

All the patients were discharged from the hospital after completion of their treatment. The antimicrobial resistance profile of all the MRSA isolates is shown in [Table/Fig-4]. All the isolates of MRSA were resistant to penicillin G and cefoxitin whereas none of the isolates were resistant to vancomycin and linezolid with variable susceptibility to other antibiotics as shown in [Table/Fig-4].

In this study, the authors report for the first time the presence of mecC gene (3.9%) in clinical isolates of MRSA recovered from a tertiary care hospital in Jammu and Kashmir, India. The results of this study were in accordance with those reported by Khan AA et al., wherein 3% of MRSA isolates were found to harbour mecC gene [10]. The percentage of mecC MRSA that was seen in this study was however slightly more than what has been reported from various European countries so far i.e., 0.45% in England, 0.06% in Germany and 2.8% in Denmark [1,6-8]. The total number of MRSA isolates was less in the present study which could have resulted in the higher percentage of mecC MRSA compared to a recent meta-analysis where the prevalence of mecC MRSA in human subgroup was estimated to be 0.004% only [15]. The mecC positive MRSA isolates have been identified from different hosts across the globe with varying frequency, with most of the human case reports being described from European subcontinent, a fact that can be attributed to a robust surveillance system for the recovery of such strains [16]. In most of the case reports, mecC MRSA were recovered from skin and soft tissue infections [17-20]. Apart from these, mecC MRSA have also been recovered from blood, urine and sputum, albeit in small numbers [16]. In this study also, all the mecC positive MRSA isolates were recovered from pus and body fluids of patients. Two isolates were from swabs, one from ET tube and one from pus.

The patients in this study from whom mecC MRSA were isolated were middle aged men (30-49 years). Most of the patients described in earlier case reports were also middle-aged or elderly [6,9,17,19,20-23] except two patients: one of whom was a 34-year-old farm worker with a history of contact with animals [20], and the other a three-year-old child [17]. MRSA isolates were recovered more from male patients in a study from Pakistan with dominant age group of 18-35 years [10]. The average age of patients with mecC MRSA in Denmark during 2007-11 was 51 years [7] whereas in Sweden in 2005-14 it was 60 years [18].

Most of the patients in the Swedish study had some kind of underlying co-morbidity or an existing skin lesion [18]. In a study from Austria, mecC MRSA infections were identified in patients with primary pathologies like diabetes mellitus, myelodysplastic syndrome, peripheral arterial occlusion disease etc., [24]. Likewise in Spain mecC MRSA was recovered from the blood sample of a patient with urothelial carcinoma [25]. In the present study, only one patient had diabetes mellitus and hypertension. He was suffering from chronic renal failure and undergoing dialysis for the same.

All the mecC MRSA isolates in this study were resistant to penicillin G and cefoxitin whereas one isolate was resistant to ciprofloxacin and erythromycin each. However, the number of these isolates was too small to deduce any statistical significance. The mecA MRSA isolates on the other hand showed high level resistance to all the antimicrobial agents tested. All S. aureus isolates were uniformly sensitive to vancomycin and linezolid. Most of the mecC MRSA isolates recovered form humans have shown good susceptibility for non beta-lactam antibiotics even though resistance to these antimicrobial agents has been reported in various studies [16]. Fluoroquinolone resistance was detected in two isolates in Germany [26] and in one isolate in Denmark [7] whereas macrolide and lincosamide resistance was detected in UK [27] and Sweden [18]. Norfloxacin resistance encoded by the sdrM gene and tetracycline resistance due to tet efflux was identified in one and two mecC MRSA CC130 isolates, respectively in Ireland [6,28].

Even though the origin of mecC MRSA is unclear, the mecC gene has also been detected in Staphylococcus stepanovicii, Staphylococcus xylosus and Staphylococcus sciuri suggesting that coagulase negative staphylococci could be the source of this resistance gene as was suggested for mecA [29]. The clinical microbiology laboratories should therefore be aware not only of mecC MRSA but of the possible occurrence of mecC in CONS as well. The mecC MRSA represents a relatively new form of MRSA that can colonise and cause severe fatal disease in human beings as well as wide range of other host species. For the confirmation of MRSA, molecular detection of either mecA by PCR or of PBP2a/PBP2′, by antibody detection test using slide agglutination assays is considered as the gold standard [30]. Clinical laboratories using cefoxitin while performing antimicrobial susceptibility tests by disc diffusion or broth/agar dilution tests for MRSA will correctly identify strains carrying the mecC gene. However, problem is where either PCR targeting mecA or slide agglutination assays for mecA-encoded PBP2a are used to identify or confirm MRSA. They will misidentify mecC MRSA as being methicillin sensitive. The laboratories thus need to incorporate universal mec gene primers that are able to amplify both mecA and mecC or use mecC specific primers when looking for such strains.

The study was limited by its small number of mecC MRSA isolates, which made the comparison of various demographic and clinical parameters difficult. Differences in methodology in the studies conducted so far worldwide complicates the understanding of the true magnitude of the problem posed by mecC MRSA. Furthermore in the present study a detailed analysis of mecC MRSA isolates to delineate the clonal complexes they belong to is missing. This can better our understanding of their origin, nature and evolution in this part of the world.

This was a first formal study that confirms the presence of mecC MRSA (3.9%) among human isolates in India. The data provides a baseline for future study and surveillance of these microorganisms. Even though the number of human mecC MRSA infections is low, continuous monitoring of these isolates is highly warranted given the great potential of transmissibility among different hosts which could increase the number of infection in humans due to mecC MRSA.