JCDR - Register at Journal of Clinical and Diagnostic Research
Journal of Clinical and Diagnostic Research, ISSN - 0973 - 709X
Microbiology Section DOI : 10.7860/JCDR/2021/49226.14994
Year : 2021 | Month : Jun | Volume : 15 | Issue : 06 Full Version Page : DC17 - DC21

Direct Detection of Extended Spectrum β-Lactamases from Positive Blood Cultures by using Aztreonam and Clavulanate

Renji Francis1, Ambica Rangaiah2, Kusuma Gowdra Rangappa3, Shwetha Jinnahalli Venugopal4

1 Postgraduate, Department of Microbiology, Bangalore Medical College, Bengaluru, Karnataka, India.
2 Professor and Head, Department of Microbiology, Bangalore Medical College, Bengaluru, Karnataka, India.
3 Lecturer, Department of Microbiology, Bangalore Medical College, Bengaluru, Karnataka, India.
4 Assistant Professor, Department of Microbiology, Bangalore Medical College, Bengaluru, Karnataka, India.


NAME, ADDRESS, E-MAIL ID OF THE CORRESPONDING AUTHOR: Shwetha Jinnahalli Venugopal, Assistant Professor, Department of Microbiology, Bangalore Medical College and Research Institute, Bangalore-560002, Karnataka, India.
E-mail: shwethanadig2000@gmail.com
Abstract

Introduction

Bacterial Sepsis by Multidrug Resistant Gram Negative Bacilli (MDRGNB) producing Extended Spectrum β-Lactamases (ESBL) is one of the major causes of mortality and morbidity in hospitals. Early detection of ESBLs directly from positive blood cultures can reduce mortality. The phenotypic detection of ESBLs is difficult as they may be masked by the co-production of additional enzymes like AmpC. This can be overcome by using an Aztreonam Discs With and Without Clavulanate (AO/CL) method.

Aim

To identify ESBLs directly from the positive blood cultures by using AO/CL disc diffusion method and to detect the genes coding for ESBL enzymes by conventional Polymerase Chain Reaction (PCR).

Materials and Methods

A prospective study was conducted over a period of five months (October 2020-February 2021). A total of 100 positive blood cultures showing Gram-negative bacilli on Gram stain was subjected to direct detection of ESBLs by using Cefotaxime (CTX), Ceftazidime (CAZ) discs with and without clavulanate and AO/CL. Isolates from positive blood culture were identified to genus and species level by VITEK-2 compact. Isolates were tested for ESBL production by CAZ/CTX with and without clavulanate disc diffusion method as recommended by CLSI. PCR was carried out to detect target genes responsible for ESBL production such as CTX–M, TEM, SHV genes. Statistical analysis was done by using MS Excel sheet. Descriptive statistics like percentage calculation was done in the study.

Results

Out of 100 positive blood cultures showing Gram Negative Bacteria (GNB) on Gram stain, 33 were positive for ESBL production by direct disc diffusion method. Out of these, 27 ESBL producers were detected by CAZ/CTX with and without clavulanate disc diffusion method and AO/CL method whereas six ESBL producers were detected by AO/CL disc diffusion method only. A 27 culture isolates were found positive for ESBL production by CAZ/CTX with and without clavulanate disc diffusion method as recommended by Clinical and Laboratory Standards Institute (CLSI). Out of 33, 28 (85%) isolates possessed one of the target genes for ESBL production such as 10TEM (36%), 10CTX-M (36%), 07TEM+CTX M (25%), 01SHV (3%).

Conclusion

Direct detection of ESBLs plays a significant role in management of sepsis. It helps the clinician in escalation and de-escalation of antibiotics and prevents the development of antimicrobial resistance. It contributes towards antibiotic stewardship and better compliance to infection prevention and control protocols. AO/CL method is preferred to detect ESBL producers directly from positive blood culture bottles.

Keywords

Bacterial sepsis,Blood stream infections,Polymerase chain reaction

Introduction

Sepsis has a major role in morbidity and mortality among critically ill patients even after the initiation of newer antibiotics. Sepsis outcome can be improved by early diagnosis [1]. Sepsis accounts for 2% of hospital admissions in developed countries. In case of critically ill patients, sepsis constitutes between 6 and 30%. Annual incidence of sepsis is found about 18 million [2]. Higher mortality rate was found to be associated with delay in the initiation of appropriate antimicrobial therapy [3].

Blood cultures are considered as the gold standard method for the diagnosis of Blood Stream Infections (BSI) [4]. Antimicrobial stewardship suggests that de-escalation of antimicrobial therapy should be done on the basis of culture reports and results in decreased antimicrobial exposure and cost savings [5]. De-escalation has an important role in antimicrobial stewardship programs [6]. Broad-spectrum antibiotics are the main stay of treatment. But irrational and inappropriate use of those leads to emergence of Multi Drug Resistance Gram Negative (MDRGNs). Appropriate usage of these can reduce the emergence of MDRGNs [7].

Clinical and Laboratory Standards Institute recommended tests give false negatives in case of coAmpc producers. To overcome this we can supplement ESBL tests with AmpC inhibitors such as boronic acid or cloxacillin performing clavulanate- or tazobactam based ESBL confirmatory tests with cefepime, which is not a substrate for AmpCs [8]. In standard laboratory practice, the time interval between the flagging of a positive blood culture and the reporting the isolate as an ESBL producer is three to four days. By testing ESBLs directly from positive blood culture bottles without performing subculture onto solid media, in order to decrease the amount of time required for the reporting of ESBLs showed high sensitivity and specificity [9].

Direct ESBL detection from positive blood culture bottles reduce turnaround time to 24 hours. By using aztreonam which acts as an inhibitor of AmpCs as well as substrate for ESBLs it can detect ESBLs in cases of coAmpc producers [10]. Therefore, the present study aids in faster detection of the ESBLs and thereby facilitates the early administration of appropriate antimicrobial therapy and also plays an important role in infection control and prevention.

Materials and Methods

A prospective study was conducted between October 2020-February 2021 at Bangalore Medical College and Research Institute, Bangalore, India. Ethical committee clearance was obtained from the institution (IEC Approval number: BMCRI/PS/1847/2020-21). Informed consent was obtained from the patient.

Sample size calculation: Based on previous study, ESBL prevalence was about 68% [11].

n=Z2pq/d2

Where, z=1.96, P=68, q=32, d=9.6,

n=(1.96)2×68×32/(9.6)2=90

Inclusion and Exclusion criteria: Positive blood culture bottles revealing gram-negative bacilli by gram stain were included. Positive blood culture bottles showing organisms other than gram-negative bacilli on gram staining and negative blood cultures were excluded.

All blood samples received for culture and sensitivity were processed by using BacT/ALERT 3D automated blood culture system according to manufacturer’s instructions. Positive blood cultures showing GNB were directly subjected to ESBL detection using CAZ, CTX discs with and without clavulanate and AO disc with and without clavulanate. For identification of the organism cultures were simultaneously subjected to Vitek-2 compact (Biomerieux) [12]. ESBL detection using CAZ/CTX with and without clavulanate disc diffusion method as recommended by CLSI performed on those culture isolates which were ESBL producers by direct ESBL method and also performed genotyping for those culture isolates.

Direct ESBL Detection by Disk Diffusion Method

All positive blood cultures were subjected to Gram stain. A total of 100 positive blood cultures showing gram-negative bacilli on Gram stain were taken for further testing. A suspension equivalent to a 0.5 McFarland standard was prepared with blood culture broth. Performed lawn culture using the suspension on Mueller-Hinton agar plates. ESBL detection was done by CLSI M 100 recommended inhibitory based methods by using CTX and CAZ discs (Himedia) with and without clavulanate. Another method of ESBL detection was done by using Aztreonam discs (Himedia) with and without clavulanate. Clavulanate solution was prepared using potassium clavulanate powder (Associate biotech) in 10 μgm/mL solution plates were incubated at 37°C for 24 hours. ESBL producers showed an inhibition zone size difference of >5 mm between the with and without clavulanate [10].

Genotyping was done for CTX-M, TEM, SHV genes. DNA extraction was done using boiling method. Master mix was procured from (Ampliqon) and PCR was carried out using thermal cycler. A reaction volume of 20 μL constitutes of DNA template, PCR buffer, MgCl, dNTPs, taq polymerase, forward and reverse primers with nuclease free water. Denaturation was carried out at 95°C for five minutes, constituting about 30 cycles of one minute duration and at 58°C and extension step at 72°C [13]. The primer sequences used are shown in [Table/Fig-1] [14]. Gel electrophoresis was done using 1% agarose gel.

Primers used for amplification of CTX-M, TEM, SHV genes.

PrimerPrimer sequence (5’-3’)Product size (bp)
CTX-M gene ForwardTTTGCGATGCAGTACCAGTAA544 bp
CTX-M gene ReverseCGTATATCGTTGGTGGTGCCATA544 bp
TEM gene ForwardATAAAATTCTTGAAGACGAAA1011 bp
TEM gene ReverseGACAGTTACCAATGCTTAATCA1011 bp
SHV gene ForwardGGGTAATTCTTATTTGTCGC930 bp
SHV gene ReverseTTAGCGTTGCCAGTGCTC930 bp

bp: Base pair


Statistical Analysis

Statistical analysis was done by using Microsoft Excel sheet. Descriptive statistics like percentage was done in the study.

Results

Out of 100 positive blood cultures showing gram negative bacilli on gram stain, 33 were ESBL producers and 67 were found to be non ESBLS by direct disc diffusion method. Age distribution of patients whose blood cultures showed GNB and ESBL producing GNBs is listed in [Table/Fig-2,3], respectively. The positive blood cultures (30%) and ESBLs (60.60%) were mainly found among neonates. ESBLs were predominantly seen among male patients as shown in [Table/Fig-4]. Organisms isolated from the positive blood cultures and ESBL producers among them are shown in [Table/Fig-5]. Acinetobacter baumanni were the predominant organism among the positive blood cultures while Klebsiella pneumoniae were predominant ESBL producers. ESBL detection by direct disc diffusion method and reference methods were performed on positive blood cultures showing GNB on Gram stain as shown in [Table/Fig-6]. Out of these 33 ESBL producers, 24 were found positive by both by CAZ/CTX with and without clavulanate disc diffusion method as recommended by CLSI and AO/CL disc diffusion method whereas six were found positive for ESBL production only by AO/CL disc diffusion method as shown by [Table/Fig-7] and three isolates were positive for ESBL production only by by CAZ/CTX with and without clavulanate disc diffusion method as recommended by CLSI as shown by [Table/Fig-8]. The 33 positive blood cultures containing ESBL producers as detected by direct disc diffusion method were subcultured and these culture isolates were subjected to ESBL detection and 27 of these culture isolates showed ESBL production by CAZ/CTX with and without clavulanate as recommended by CLSI. Turnaround time was found to be 24 hours for direct ESBL detection whereas it was found to be 48-72 hours for detection of ESBL producers from culture isolates.

Age distribution among patients showing positive blood cultures.

AgePositive blood cultures showing GNB (n=100)
0-<30 days30
30 days-1 years15
1-10 years5
10-20 years10
20-30 years5
30-40 years10
40-50 years5
50-60 years10
60-70 years10

Age distribution among patients showing ESBL producers (n=33).

AgeESBLs, n (%)
30 days20 (60.60)
30 days-1 years10 (30.30)
10-20 years3 (9.09)

Sex distribution among patients showing GNB and ESBL producers from positive blood cultures.

GenderPositive blood cultures showing GNB (n=100)ESBLs (n=33)
Male6320
Female3713

ESBLs from positive blood cultures.

OrganismsNumber of isolates (n)Number of ESBL isolates (n)
Acinetobacter baumanni355
Klebsiella pneumoniae3116
Escherichia coli188
Salmonella typhi60
Acinetobacter lwoffi52
Enterobacter aerogenes52
Total10033

Detection of ESBLs by test and reference methods.

ESBL producers (n=33)Test methodReference method
Direct disc diffusion methodCAZ/CTX with and without clavulanate disc diffusion method as recommended by CLSIPCR
Klebsiella pneumoniae (16)161214
Escherichia coli (8)877
Acinetobacter baumanni (5)554
Acinetobacter lwoffi (2)221
Enterobacter aerogenes (2)212
Total332728

Direct detection of ESBLs by AO/CL Method.

Detection of ESBLs by direct disc diffusion methods.

ESBL producers (n=33)Direct disc diffusion method
By CAZ/CTX with and without clavulanate disc diffusion method as recommended by CLSI onlyBy AO/CL disc diffusion method onlyBy both methods
Klebsiella pneumoniae (16)2410
Escherichia coli (8)017
Acinetobacter baumanni (5)104
Acinetobacter lwoffi (2)002
Enterobacter aerogenes (2)011
Total3624

Out of 33 ESBLs, 28 had genes responsible for ESBL production such as TEM 10 (36%), CTX-M 10 (36%), TEM+CTX M 7 (25%), SHV 1 (3%) genes as detected by PCR as shown in [Table/Fig-9]. Gel electrophoresis pattern for TEM, CTX-M and SHV genes is shown in [Table/Fig-10,11 and 12]. In 05 (17.8%) isolates none of the target genes were found. Out of these five genotypically negative isolates, four were found positive for ESBL production by all the three phenotypic methods and one detected by AO/CL method alone. Out of six ESBL producers which were detected by only AO/CL method, five of them had genes responsible for ESBL production as shown in [Table/Fig-13].

Genotyping of ESBL isolates.

Organisms (n=33)Genotypic method (n=28)Genes present
CTX M [n=10] (36%)TEM (n=10) (36%)CTX M+TEM (n=7) (25%)SHV (n=1) (3%)
Klebsiella pneumoniae (16)145630
Escherichia coli (8)72221
Acinetobacter baumanni (5)42110
Enterobacter aerogenes (2)21100
Acinetobacter lwoffi (2)10010

PCR for bla TEM GENE.

L-Ladder100-1000 bp; PC-Positive control TEM Gene positive isolates-1,2,4,5,7,8,9,10,11,13

PCR for bla CTX-M GENE.

L-Ladder100-1000 bp; PC-Positive control CTX-M Gene positive isolates-1,2,3,4,5

PCR for bla TEM and SHV GENES.

L-Ladder100-1000 bp; PC1-Positive control for TEM; PC2-Positive control for SHV TEMGene positive isolates-1,4; SHV Gene positive isolate-2

Detection of ESBLs by AO/CL and PCR.

ESBL producers (n=6)By AO/CL disc diffusion method only (n=6)PCR (n=5)
Klebsiella pneumonia (4)4CTX-M-2 TEM-1
Escherichia coli (1)1CTX-M+TEM-1
Enterobacter aerogenes (1)1TEM-1
Total65

Discussion

Rapid detection of ESBL producing bacteria is important to choose appropriate antibiotics for treatment. It plays a significant role in antibiotic stewardship and infection control. With this information clinician can either continue with broad spectrum antibiotics started as empirical treatment or step up with combination of β-lactam- β-lactamase inhibitors or carbapenems as justified with clinical condition. This study was taken up to detect ESBL producers directly from positive blood culture bottles hence shortening the delay; using Aztreonam disc with and without clavulanic acid was assessed along with CAZ/CTX with and without clavulanate as recommended by CLSI.

In the present study, ESBL producers from positive blood culture broth constituted 33% which is comparable with the studies conducted by Doret L et al., Bianco G et al., and Navon-Venezia S et al., [15-17]. Out of 33 (33%) ESBL isolates, 26 (78.78%) belongs to family Enterobacteriacea and remaining 7 (21.21%) belonging to nonfermenters. Among Enterobacteriacea family 16 (48.5%) of the ESBL isolates were of K. pneumonia followed by E. coli.

Direct ESBL detection from positive blood cultures using CAZ/CTX with and without clavulanate disc by CLSI guidelines and by AO/CL disc diffusion method detected 90% of ESBLs. A study conducted by Thomson GK et al., using improved method from the culture isolates also shown similar results shown by present study [8]. The advantage of this study is direct detection of ESBL producers from positive blood culture bottles showing GNB on Gram stain reduced the turnaround time for reporting of ESBL producers to 24 hours from obtaining positive blood culture which in contrast to more than 48-72 hours when ESBL producers are detected from culture isolates as done by Thomson GK et al., [8].

By using CAZ/CTX 81% of ESBLs were directly detected from positive blood cultures. This study detected 33% of ESBLs by phenotypic method from positive blood cultures. Similar results were shown by studies conducted Poulou A et al., Kazemian H et al., and Jabeen K et al., but performed on the culture isolates instead of using positive blood cultures [18-20]. In the present study, it was observed that ESBL detection from positive blood cultures by direct method (CAZ/CTX with and without clavulanate) were showing comparable results with ESBLs producers from culture isolates of those positive blood cultures by CLSI recommended method.

A 28% ESBLs showed positive for the ESBL target genes such as CTX-M, TEM, SHV which is similar to the study conducted by Krishnamurthy V et al., [14]. Present study showed 10 TEM (36%), 10 CTX-M (36%), seven TEM+CTX M(25%), one SHV (3%) genes. A 5 (15.15%) of ESBLs detected by phenotypic method didn’t possess any of the gene targets tested in this study. It may be due to the presence of ESBL genes other than the ones detected in this study.

Therefore, direct ESBL testing from positive blood cultures helps in early reporting of ESBLs which inturn guides the treating physician in facilitating rapid initiation of appropriate treatment. The time delay associated with CLSI standard methods accounts for 48-72 hours which constitutes sub culturing onto a solid culture medium, ESBL screening and confirmatory ESBL test. The present study showed that direct ESBL testing from positive blood culture bottles is easy to perform and yields results within 24 hours reducing time delay. Apart from that by using Aztreonam discs for ESBL detection shows additional advantage. Aztreonam is a substrate for ESBL as well as inhibitor of Ampc, it will increase the detection rate in case of CoAmpc producers.

Limitation(s)

Detection of ESBL producers were carried from 100 positive blood cultures showing GNB on gram stain. Larger sample size should be included in further studies in order to determine efficiency of this method.

Conclusion(s)

Direct detection of ESBL producers from positive blood culture specimens by using AO/CL disc is preferred because of reduced turnaround time and also an inexpensive test requiring only one substrate.

Author Declaration:

    Financial or Other Competing Interests: None

    Was Ethics Committee Approval obtained for this study? Yes

    Was informed consent obtained from the subjects involved in the study? Yes

    For any images presented appropriate consent has been obtained from the subjects. NA

Plagiarism Checking Methods: [Jain H et al.]

    Plagiarism X-checker: Mar 03, 2021

    Manual Googling: Apr 15, 2021

    iThenticate Software: Apr 24, 2021 (19%)

ETYMOLOGY:

Author Origin

References

[1]Gul F, Arslantaş MK, Cinel İ, Kumar A, Changing definitions of sepsis Turk J Anaesthesiol Reanim 2017 45(3):129-38.10.5152/TJAR.2017.9375328752002  [Google Scholar]  [CrossRef]  [PubMed]

[2]Martin GS, Sepsis, severe sepsis and septic shock: Changes in incidence, pathogens and outcomes Expert Rev Anti Infect Ther 2012 10(6):701-06.10.1586/eri.12.5022734959  [Google Scholar]  [CrossRef]  [PubMed]

[3]Fan SL, Miller NS, Lee J, Remick DG, Diagnosing sepsis- The role of laboratory medicine Clin Chim Acta 2016 460:203-10.10.1016/j.cca.2016.07.00227387712  [Google Scholar]  [CrossRef]  [PubMed]

[4]Mancini N, Carletti S, Ghidoli N, Cichero P, Burioni R, Clementi M, The era of molecular and other non-culture-based methods in diagnosis of sepsis Clin Microbiol Rev 2010 23(1):235-51.10.1128/CMR.00043-092006533210.1086/51039317173212  [Google Scholar]  [CrossRef]  [PubMed]  [CrossRef]  [PubMed]

[5]Dellit TH, Owens RC, McGowan JE Jr, Gerding DN, Weinstein RA, Burke JP, Infectious Diseases Society of America and the Society for Healthcare Epidemiology of America Guidelines for developing an institutional program to enhance antimicrobial stewardship Clin Infect Dis 2007 44:159-77.  [Google Scholar]

[6]Masterton RG, Antibiotic De-Escalation Crit Care Clin 2011 27(1):149-62.10.1016/j.ccc.2010.09.00921144991  [Google Scholar]  [CrossRef]  [PubMed]

[7]Tamma PD, Cosgrove SE, Maragakis LL, Combination therapy for treatment of infections with gram-negative bacteria Clin Microbiol Rev 2012 25(3):450-70.10.1128/CMR.05041-1122763634  [Google Scholar]  [CrossRef]  [PubMed]

[8]Thomson GK, Ayaz M, Lutes K, Thomson KS, An improved Extended-Spectrum-β-Lactamase detection test utilizing aztreonam plus clavulanate J Clin Microbiol 2017 56(1):e01309-17.10.1128/JCM.01309-1729046407  [Google Scholar]  [CrossRef]  [PubMed]

[9]Navon-Venezia S, Ben-Ami R, Schwaber MJ, Leavitt A, Schwartz D, Carmeli Y, Protocol for the accelerated detection of extended-spectrum beta-lactamase- producing Escherichia coli and Klebsiella pneumonia strains from blood cultures Eur J Clin Microbiol Infect Dis 2004 23(3):200-02.10.1007/s10096-003-1086-014767680  [Google Scholar]  [CrossRef]  [PubMed]

[10]CLSI. Performance standards for antimicrobial susceptibility testing. 29th ed. CLSI supplement M100. Wayne, PA: Clinical and Laboratory Standards Institute; 2018  [Google Scholar]

[11]Mathur P, Kapil A, Das B, Dhawan B, Prevalence of extended spectrum beta lactamase producing gram negative bacteria in a tertiary care hospital Indian J Med Res 2002 115:153-57.  [Google Scholar]

[12]Shetty PC, Luqman TS, Kulkarni RD, Koti PY, Comparative evaluation of antibiotic susceptibility testing on vitek-2 compact and direct sensitivity testing from blood cultures from a teritiary care centre in South India J Pure Appl Microbiol 2018 12(2):913-20.10.22207/JPAM.12.2.54  [Google Scholar]  [CrossRef]

[13]Tribuddharat C, Srifeuengfung S, Chiangjong W, A correlation between phenotypes and genotypes of Extended-spectrum beta-lactamase producing Klebsiella pneumonia J Infect Dis Antimicrob Agents 2007 24:117-23.  [Google Scholar]

[14]Krishnamurthy V, Vijaykumar GS, Sudeepa Kumar M, Prashanth HV, Prakash R, Nagaraj ER, Phenotypic and genotypic methods for detection of extended spectrum β lactamase producing Escherichia coli and Klebsiella pneumonia isolated from ventilator associated pneumonia J Clin Diagn Res 2013 7(9):1975-78.10.7860/JCDR/2013/6544.337624179913  [Google Scholar]  [CrossRef]  [PubMed]

[15]Dortet L, Poirel L, Nordmann P, Rapid detection of ESBL-producing Enterobacteriaceae in blood cultures Emerg Infect Dis 2015 21(3):504-07.10.3201/eid2103.14127725695535  [Google Scholar]  [CrossRef]  [PubMed]

[16]Bianco G, Boattini M, Iannaccone M, Fossati L, Cavallo R, Costa C, Direct β-lactam inactivation method: a new low-cost assay for rapid detection of carbapenemase- or extended-spectrum-β-lactamase-producing enterobacterales directly from positive blood culture bottles J Clin Microbiol 2019 58(1):e01178-19.10.1128/JCM.01178-1931694972  [Google Scholar]  [CrossRef]  [PubMed]

[17]Navon-Venezia S, Leavitt A, Ben-Ami R, Aharoni Y, Schwaber MJ, Schwartz D, Evaluation of an accelerated protocol for detection of extended-spectrum beta-lactamase-producing gram-negative bacilli from positive blood cultures J Clin Microbiol 2005 43(1):439-41.10.1128/JCM.43.1.439-441.200515635009  [Google Scholar]  [CrossRef]  [PubMed]

[18]Poulou A, Grivakou E, Vrioni G, Koumaki V, Pittaras T, Pournaras S, Modified CLSI ESBL confirmatory test for phenotypic detection of ESBL among Enterobacteriaceae producing various β-Lactamases J Clin Microbiol 2014 52(5):1483-89.10.1128/JCM.03361-1324574283  [Google Scholar]  [CrossRef]  [PubMed]

[19]Kazemian H, Heidari H, Ghanavati R, Ghafourian S, Yazdani F, Sadeghifard N, Phenotypic and Genotypic Characterization of ESBL-, AmpC-, and Carbapenemase-Producing Klebsiella pneumoniae and Escherichia coli Isolates Med Princ Pract 2019 28(6):547-51.10.1159/00050031130995662  [Google Scholar]  [CrossRef]  [PubMed]

[20]Jabeen K, Zafar A, Hasan R, Comparison of double disc and combined disc method for the detection of extended spectrum beta lactamases in enterobacteriaceae J Pak Med Assoc 2003 53(11):534-36.  [Google Scholar]