JCDR - Register at Journal of Clinical and Diagnostic Research
Journal of Clinical and Diagnostic Research, ISSN - 0973 - 709X
Microbiology Section DOI : 10.7860/JCDR/2020/43328.13515
Year : 2020 | Month : Feb | Volume : 14 | Issue : 02 Full Version Page : DC10 - DC15

Role of Extended Spectrum Beta Lactamases in Cephalosporin and Carbapenem Resistance in Escherichia coli from Inpatients and Outpatients in Nigeria

Akinwale Majeed Akinlabi1, Afolabi Oluwadun2, Oyebode Armstrong Terry Alli3, Adeolu Sunday Oluremi4, Mark A Webber5, David Olusoga Ogbolu6

1 Research Assistant, Department of Medical Microbiology and Parasitology, Olabisi Onabanjo University, Ago-Iwoye, Ogun, Nigeria.
2 Professor, Department of Medical Microbiology and Parasitology, Olabisi Onabanjo University, Ago-Iwoye, Ogun, Nigeria.
3 Professor, Department of Biomedical Science, Ladoke Akintola University of Technology, Ogbomoso, Oyo, Nigeria.
4 Research Assistant, Department of Biomedical Science, Ladoke Akintola University of Technology, Ogbomoso, Oyo, Nigeria.
5 Research Group Leader, Department of Microbes in the Food Chain, Quadram Institute Bioscience, Norwich, England, United Kingdom.
6 Reader, Department of Biomedical Science, Ladoke Akintola University of Technology, Ogbomoso, Oyo, Nigeria.


NAME, ADDRESS, E-MAIL ID OF THE CORRESPONDING AUTHOR: Dr. David Olusoga Ogbolu, Department of Biomedical Sciences, College of Health Sciences, Ladoke Akintola University of Technology, Ogbomoso P.M.B. 4000 Nigeria.
E-mail: doogbolu@lautech.edu.ng
Abstract

Introduction

Antimicrobial resistance requires global coordinated action with a view to addressing its rising threat. Prevalence of antimicrobial resistance has been increasing worldwide in both developed and developing countries. Whilst cephalosporin and carbapenem resistance is a problem in Escherichia coli in Nigeria, there is a paucity of information regarding the mechanisms of resistance underpinning this in prevalence and types of extended spectrum in clinical E. coli.

Aim

To detect and characterise Extended Spectrum β Lactamases (ESBL) in clinical E. coli from inpatients and outpatients in Nigeria.

Materials and Methods

A total of 104 E. coli were obtained from 498 non-duplicate clinical specimens from Northern Nigeria between November 2017 and November 2018. Antibiotic susceptibility of third generation cephalosporin including other important antibiotics and phenotypic detection of ESBL of the isolates were determined. Genotypic detection of ESBL and randomly amplified polymorphic DNA to determine clonality were used to further characterise 44 E. coli isolates selected based on their phenotypes and clinical specimens. The data were analysed with the aid of statistical package for social sciences (IBM SPSS), version 21.0 and were reported in frequency tables and in percentages.

Results

Majority of the E. coli isolates showed no clonal relationships. More than half of E. coli were resistant to third generation cephalosporin class of antibiotics. There was no difference between MIC50 and MIC90 values for the majority isolates for most drugs where MICs ≥256 μg/mL were the norm except for carbapenems with low level resistance. In total, 44/104 (42.3%) E. coli were ESBL producers. blaCTX-M was the dominant ESBLs seen in 75% (33/44) of isolates, of these blaCTX-M-15 variant was most common and seen in 72.7% (24/33) of isolates followed by blaVEB, 21/44 (47.7%) and blaPER 6/44 (13.6%). No AmpC or carbapenemase genes were identified.

Conclusion

E. coli isolates from Northern Nigeria are highly multi-drug resistant with only carbapenems of common therapeutic drug classes retaining significant activity. Beta-lactam resistance is largely underpinned by carriage of CTX-M-15 and carbapenem resistance is likely to be a result of ESBL carriage with other mechanisms.

Keywords

Introduction

Antimicrobial resistance is a public health concern that requires a global coordinated action with a view to address its rising threat. Antimicrobial resistance has been increasing in prevalence worldwide in both developed and developing countries [1,2]. Most worrisome is limited resources in developing countries, which has inadvertently exacerbated the growing threat of antimicrobial resistance [2]. The annual death resulting from antibiotic resistant infections has been estimated globally at about 700,000 people and the deaths have been projected to hit 10 million by 2050 [3]. About half of those deaths are projected to occur in Africa because of non-effectiveness of currently available antibiotics and the non-availability and non-affordability of highly potent or alternative antibiotics [3].

Beta-lactamase production by Enterobacteriaceae is the most important single mechanism of resistance to beta-lactam antibiotics (penicillins, cephalosporins, monobactams and carbapenems), which are often used to treat nosocomial and community acquired infections. ESBL enzymes which are commonly produced by E. coli and Klebsiella pneumoniae hydrolyze third generation cephalosporins and monobactam thus rendering them ineffective against ESBL producing organisms, thus increasing costs, length of hospital stay, burden of disease and ultimately morbidity and mortality rates [4]. ESBL hydrolyze beta-lactams such as cefotaxime, ceftriaxone and ceftazidime, ampicillin, penicillins and aztreonam [5].

ESBL producing E. coli have been reported worldwide with varying prevalences although rates tend to be highest in lower income countries [6]. In Nigeria, there have been varying reports on the prevalence of beta-lactamase genes amongst Gram-negative pathogens from the South-West [7,8] and South-East [9] of the country. However, there is a dearth of information on the epidemiology of ESBL genes in E. coli from the North, though there are some pockets of phenotypic studies in some individual cities/regions like Maiduguri and Jos [10,11]. In order to bridge this gap between southern and northern Nigeria, this study was designed to detect and characterise ESBL resistance in clinical isolates of E. coli from northern Nigeria.

Materials and Methods

This was a prospective convenient cross-sectional study. Four hundred and ninety-eight clinical specimens were obtained using formulae, N=Z2Pq/d2 [12] based on the prevalence of 79.8% [13]. The specimens (included ear swab, wound, eye swab, urine, stool, high vaginal swab, cerebrospinal fluid and blood culture) were collected between November 2017 and November 2018 at the Aminu Kano Teaching Hospital, Kano, Federal Medical Centre, Katsina and Asokoro District Hospital, Abuja. Both outpatients and inpatients of these hospitals were recruited into the study following ethical approvals and informed consent from the patients. Ethical approvals were sought and obtained from the Research and Ethics Committee of the three hospitals with reference numbers; FHREC/2018/01/95/14-08-18 for Asokoro District Hospital, Abuja, NHREC/21/08/2008/AKTH/EC/2301 for Aminu Kano Teaching Hospital, Kano, while Federal Medical Centre, Katsina had no reference number but approval letter was obtained.

The patients recruited into the study had age range of <11 months to 71 years with both males and females. Clinical and demographic data, such as age, gender and patient status (Inpatient or Outpatient) were collected from all patients using a proforma.

Inclusion criteria: All patients that endorsed informed consent form and filled questionnaire (questions such as age, sex, recent use of antibiotics, whether it was self-medication or by prescription, history of travel and so on) were included in the study from the three hospitals.

Exclusion criteria: All patients that refused to sign or thumb print the informed consent forms and questionnaires were excluded from the study.

AKTH and FMCK are tertiary hospitals while ADHA is a secondary hospital.

Cultural Isolation and Identification

Clinical samples were cultured on Blood and MacConkey agars (Oxoid, U.K) overnight at 37°C and E. coli was identified using conventional microbiological procedures [14]. All E. coli isolates were further confirmed using Microbact 12A/12E (Oxoid, UK). This identification and other experiments were carried out at Molecular Biology laboratory of Department of Medical Laboratory Science, Ladoke Akintola University of Technology, Osogbo, Nigeria.

Antimicrobial Susceptibility Testing

The antibiotic susceptibility patterns of the 104 E. coli isolates to a panel of 9 antibiotics including representative of third generation cephalosporin, comprising ceftazidime (30 μg), cefotaxime (30 μg), meropenem (10 μg), imipenem (10 μg), ciprofloxacin (5 μg), gentamicin (10 μg), ertapenem (10 μg), amoxy-clavulanate (30 μg), Ampicillin (10 μg) were determined by the disc diffusion method (Oxoid, UK) using Mueller-Hinton agar (Oxoid, UK) according to CLSI guidelines [15]. Isolates were further selected for minimum inhibitory concentrations to ceftazidime, amoxyclav, ciprofloxacin, ampicillin, cefotaxime and gentamicin using agar dilution method. All runs included the control organism E. coli ATCC 25922.

Detection and Identification of Beta-lactamase Genes

All isolates were tested for production of ESBL/AmpC and carbapenemase based on susceptibility testing using the disc based ‘ESBL/AmpC and Carbapenemase detection set’ from Mast Diagnostics (Bootle, UK) following manufacturer’s protocol and interpreted using the ‘ESBL/AmpC and carbapenemase detection set calculator’ tools also as per the manufacturer’s guidelines. Polymerase Chain Reaction (PCR) was used to detect β-lactam resistance genes from 44 isolates (selected to cover all phenotypes present) using primers shown in [Table/Fig-1] as previously described [7,16,17]. Control strains obtained from the Health Protection Agency (HPA) (now part of Public Health England, PHE) included for each gene. Amplimers resulting from these PCR reactions were sequenced to confirm the identity and specific variant of each gene identified and sequences were aligned to known reference sequences using Clustal Omega (https://www.ebi.ac.uk/Tools/msa/clustalo).

Primers used for amplification of β-lactamase genes.

PrimerDNA sequence (5′ to 3′)Annealing temp (°C)Product size (bp)
NDM FNDM RTTGATGCTGAGCGGGTGCTGTCCTTGATCAGGCAGC56578
KPC FKPC RATGTCACTGTATCGCCGTCTTAGACGGCCAACACAATAGG56785
OXA 48 FOXA 48 RTTCGGCCACGGAGCAAATCAGGATGTGGGCATATCCATATTCATCGCA56240
VIM FVIM RAGTGGTGAGTATCCGACAGATGAAAGTGCGTGGAGAC56261
IMP FIMP RCTACCGCAGCAGAGTCTTTGAACCAGTTTTGCCTTACCAT58587
GES FGES RCGGTTTCTAGCATCGGGACACATCCGCCATAGAGGACTTTAGCACAG58263
SME FSME RAACGGCTTCATTTTTGTTTAGGCTTCCGCAATAGTTTTATCA58830
IMI FIMI RGAGGGTATGACTAAATTCATGCGGTCGAGCAGGTGTAGATGTGTCACGTCATCG58116
PER-1FPER-1RATGAATGTCATTATAAAAGCAATTTGGGCTTAGGGCAGAA51590
VEB FVEB RCGACTTCCATTTCCCGATGCGGACTCTGCACCAAATACGC55604
OXA-10 FOXA-10 RGTCTTTCGAGTACGGCATTAATTTTCTTAGCGGCAACTTAC52600
OXA FOXA RATATCTCTACTGTTGCATCTCCAAACCCTTCAAACCATCC50216
CTX-M-1 FCTX-M-1 RGACGATGTCACTGGCTGAGCAGCCGCCGACGCTAATACA60499

NDM: New Delhi Metalobeta-lactamase; KPC: Klebsiella pneumoniae carbapenemase; OXA: Oxacillinase; VIM: Verona Integron-encoded Metalobetalactamase; GES: Guiana extended spectrum beta-lactamase; PER: Pseudomonas extended spectrum resistant; VEB: Vietnam extended spectrum beta-lactamase; CTX-M: Cefotaximase munich; SME: Serratia marcescens enzyme; IMI: Imipenem hydrolysing beta-lactamase; IMP: Imipenemase


Random Amplified Polymorphic DNA and Polymerase Chain Reaction Typing

The epidemiological relationships between strains of E. coli analysed by random amplified polymorphic DNA. The primers sequence and PCR running conditions used were according to Vogel I et al., [18], modified to use 1 μL of 100 μm of primers at a final concentration of 0.02 μm [19]. The experiment was repeated to ensure reproducibility. DNA fingerprints were compared by visual inspection to assign similar banding patterns to the same Random Amplified Polymorphic DNA (RAPD) type.

Statistical Analysis

Data from this study were reported in frequency tables and percentages. The data were analysed with the aid of statistical package for social sciences (IBM SPSS), version 21.0.

Results

In total, 104 (60.5%) non-duplicate clinical E. coli strains were obtained from 172 Gram negative bacilli identified in the three hospitals (from 498 clinical specimens). Out of these 104 isolates, 61 (58.7%) were from females while 43 (41.3%) were from males. The age range of the participants in this study was between 11 months and 71 years, 70.2% was found between age range 11-40 years. Similarly, 51 (49.0%%) E. coli were found in Inpatients and 53 (51%) Outpatients. Disc susceptibility of 104 E.coli isolates showed that 93 were largely resistant to ampicillin (89.4%), 75 amoxicillin-clavulanic acid (72.1%), while ciprofloxacin and gentamicin had resistance rate of 73 (70.2%) and 64 (61.5%) respectively. More than half of E. coli were resistant to third generation cephalosporin class of antibiotics used in this study, they comprised cefotaxime with resistant rate of 74 (71.2%) and ceftazidime 53 (51.0%). Carbapenem resistance was less common; ertapenem (7.7%), imipenem (4.8%) and meropenem (2.9%) [Table/Fig-2]. MIC of six antibiotics further confirmed resistance shown by disc susceptibility with the majority of isolates having an MIC 256 μg/mL with no difference between MIC50 and MIC90 for almost all the isolates [Table/Fig-3].

Summary of antimicrobial disc susceptibility testing of 104 E. coli isolates.

Antibiotic (μg/mL)Sensitive n (%)Intermediate n (%)Resistant
Ceftazidime (30)47 (45.2)4 (3.8)53 (51.0)
Meropenem (10)101 (97.1)0 (0.0)3 (2.9)
Imipenem (10)98 (94.2)1 (1.0)5 (4.8)
Cefotaxime (30)30 (28.8)0 (0.0)74 (71.2)
Ciprofloxacin (5)26 (25.0)5 (4.8)73 (70.2)
Gentamicin (10)31 (29.8)9 (8.7)64 (61.5)
Ertapenem (10)92 (88.5)4 (3.8)8 (7.7)
Amoxy-clavulanate (30)22 (21.2)7 (6.7)75 (72.1)
Ampicillin (10)7 (6.7)4 (3.9)93 (89.4)

Numbers in parentheses are percentages


Minimum inhibitory concentrations of E. coli isolates.

IsolateAntimicrobial agentsMIC (0.06 -256) μg/mL)Sensitive n (%)Intermediate n (%)Resistant n (%)
MIC50MIC90
Escherichia coliCefotaxime2562560 (0.0)2 (1.9)102 (98.1)
Ceftazidime12825610 (9.6)15 (14.4)79 (76.0)
Amoxyclav2562560 (0.0)3 (2.9)101 (97.1)
Ampicillin2562560 (0.0)0 (0.0)104 (100.0)
Ciprofloxacin2562562 (1.9)0 (0.0)102 (98.1)
Gentamicin12825617 (16.3)4 (3.9)83 (79.8)

Numbers in parentheses are percentages


Phenotypic Detection of Beta-lactamases

Phenotypic detection of beta-lactamases revealed 44 isolates (42.3%) to be ESBL-producers, AmpC enzymes were present in 15 isolates (14.4%) while 27 (26.0%) were predicted to be carbapenemase producers. Analyses of sources revealed that 28 out of 51 isolates (54.9%) from inpatients produced ESBLs while for outpatients only 16 of 53 (30.2%). Breakdown according to the hospital showed that E. coli from AKTH had more ESBL and carbapenemase resistance (59.3% and 40.7% respectively) while FMCK had more putative AmpC producers (19%) than others [Table/Fig-4].

Phenotypic distribution of beta-lactamases in 104 E. coli.

StatusNumberESBL present n (%)ESBL absent n (%)AmpC present n (%)AmpC absent n (%)Carba present n (%)Carba absent n (%)
Inpatients5128 (54.9)23 (45.1)10 (19.6)41 (80.4)20 (39.2)31 (60.8)
Outpatient5316 (30.2)37 (69.8)5 (9.4)48 (90.6)7 (13.2)46 (86.8)
Total10444 (42.3)60 (57.7)15 (14.4)89 (85.6)27 (26.0)77 (74.0)
Hospital
FMCK219 (42.9)12 (57.1)4 (19.0)17 (81.0)4 (19.0)17 (80.9)
ADHA5619 (33.9)37 (66.1)6 (10.7)50 (89.3)12 (21.4)44 (78.6)
AKTH2716 (59.3)11 (40.7)5 (18.5)22 (81.5)11 (40.7)16 (59.3)
Total10444 (42.3)60 (57.7)15 (14.4)89 (85.6)27 (26.0)77 (74.0)

Carba: Carbapenemase. Numbers in parentheses show percentages


Genotypic Detection of ESBL

PCR and sequencing identified different ESBL encoding genes in the 44 ESBL producers. blaCTX-M were identified from 33/44 (75%) isolates, of which blaCTX-M-15 has the dominant variant for 24/33 (72.7%) isolates, all isolates had multiple ESBL genes between 2 and 5. blaCTX-M-2 had 18/33 (54.5%), blaCTX-M-9 11/33 (33.3%), blaCTX-M-8 10/33 (30.3%) and blaCTX-25 6/33 (18.2%). Other ESBL genes identified were blaOXA variants 17/44 (38.6%), of these blaOXA-10 was the dominant variant with 6/17 (35.3%), blaSHV genes were seen in 11/44 (25.0%); blaVEB from 21/44 (47.7%) and blaPER in 6/44 (13.6%) [Table/Fig-5]. However, no AmpC or carbapenemase genes were detected. ESBL genes were detected in different proportions with varying diagnosis and sources in these hospitals [Table/Fig-6]. Percentage distribution of the ESBL genes between inpatients and outpatients showed blaCTX-M/blaCTX-M-15 to be more prevalent 93.8%/56.3% in outpatients compared to inpatients 89.3%/53.6%. Among the specimens, urine exhibited highest prevalence of ESBL genes 19/44 (43.2%) followed by stool and wound having 8/44 (18.2%) and 6/44 (13.6%) respectively, least prevalence was found in Semen, Ear and Eye swabs with prevalence of 2.3% each.

Carriage of beta-lactamases in E. coli isolates.

Serial #ID no.DiagnosisSpecimenSourceMIC (μg/mL)Phenotypeβ-lactam gene
CTXCFZAMCAmpCIPGENEAC
1AD 03UTIUrineOP256128256256256256+-+CTX-M-15, CTX-M-2
2AD 04UTIUrineIP256256256256256256+--PER, VEB, SHV, OXA
3AD 05GETStoolIP256128128256128256++-CTX-M-15, CTX-M-9
4AD 06GETStoolOP256256256256256128+--CTX-M-15, CTX-M-2, VEB
5AD 07SepsisWoundIP256256256256256256+--SHV, CTX-M-15, OXA
6AD 08UTIUrineIP256256256256256256++-CTX-M-2, CTXM-8, CTX-M-15,
7AD 09GETStoolIP256256256256256256+--CTX-M-15, OXA, CTX-M-2, VEB
8AD 17GTIHVSOP256256256256128256+++CTXM-8, VEB, CTX-M-15
9AD 21SepsisWoundIP256256256256256256+-+CTX-M-15, OXA, CTX-M-25
10AD 22UTIUrineIP256128256256256256+--VEB, CTX-M-15
11AD 26SepsisWoundOP256256256256256256+-+CTX-M, SHV, OXA-10, CTX-M-2
12AD 30GTIHVSIP256256256256256256++-CTX-M-2 VEB,
13AD 47InfertilitySemenOP256256256256256256+--SHV, CTX-M-15
14AD 52UTIUrineIP256256256256256256+-+CTX-M-15, CTX-M-2,
15AD 56GTIHVSOP256256256256256256+--CTX-M, VEB,
16AD 60UTIUrineOP256256256256256256++-PER, VEB, CTX-M-15
17AD 65UTIUrineIP256256256256256128+-+CTX-M, OXA, VEB, OXA-10
18AD 78GTIHVSIP256256256256256256+-+SHV, VEB, CTX-M-2
19AD 84UTIUrineOP256256256256128256++-VEB, SHV, CTX-M-8
20AK 08SepticaemiaBloodIP256256256256256256+--CTX-M-15, VEB, SHV, CTX-M-9
21AK 11UTIUrineOP256256256256256256+-+CTX-M-8, CTX-M-25, VEB, CTX-M-15
22AK 16GETStoolOP256256256256256256+-+CTX-M-15, CTX-M-25, PER
23AK 17UTIUrineIP256256256256256128+-+CTX-M-15, CTX-M-9, VEB, OXA
24AK 20SepsisWoundIP256256256256256256+--CTX-M-15, CTX-M-2, CTX-M-9,
25AK 22GTIHVSOP256256256256256256+-+SHV, CTX-M-8 CTX-M-2, OXA
26AK 23GTIHVSIP256256256256256256+--CTX-M-15, CTX-M-8, OXA, OXA-10
27AK 24UTIUrineIP256256256256128256+-+CTX-M-9, CTX-M-2, SHV,
28AK 27UTIUrineOP256256256256256256+--CTX-M-9, VEB, CTX-M-2
29AK 28GETStoolIP256256256256256256+--CTX-M-2, VEB, OXA
30AK 31SepticaemiaBloodIP256256256256256256+--CTX-M-15 SHV, CTX-M-8, VEB
31AK 32Otitis mediaEar swabIP256256256256256256+--CTX-M-15, VEB, CTX-M-25
32AK 41ConjunctivitisEye swabIP256256256256256256+-+CTX-M-2, CTX-M-9, OXA, PER
33AK 49UTIUrineIP256256256256256256+--CTX-M-8, CTX-M-2, CTX-25
34AK 53UTIUrineOP256256256256256256+++OXA, OXA-10, PER
35AK 59SepsisWoundIP256256256256256256+--OXA, CTX-M-2, CTX-M-9
36FM 06UTIUrineOP256256256256256256++-CTX-M-15, CTX-M-25, OXA
37FM 10UTIUrineIP256256256256256128+--CTX-M-2 SHV, VEB, CTX-M-9
38FM 14GETStoolIP256256256256256256+-+OXA, SHV, CTX-M-8
39FM 15SepsisWoundOP256256256256256256+--CTX-M-15, VEB, CTX-M-9
40FM 19GETStoolIP256256256256256256+--OXA, OXA-10, PER
41FM 21UTIUrineIP256256256256256256+-+CTX-M-8, CTX-M-15, CTX-M-2
42FM 25UTIUrineIP256256256256256256+--CTX-M-15, SHV, CTX-M-9, OXA
43FM 31GETStoolOP256256256256256256+-+CTX-M-8, CTX-M-2
44FM 36UTIUrineIP256256256256256256++-VEB, OXA, OXA-10

AD: Asokoro District Hospital Abuja; AK: Aminu Kano Teaching Hospital, Kano; FM: Federal medical centre, Katsina; CTX: Cefotaxime; CFZ: Ceftazidime; AMC: Amoxycillin-clavulanic acid; Amp: Ampicillin; CIP: Ciprofloxacin; GEN: Gentamicin; UTI: Urinary tract infection; GET: Gastroenteritis; GTI: Genital tract infection; HVS: High vaginal swab; OP: Outpatient; IP: Inpatient; E: Extended spectrum β-lactamase; A: AmpC; C: Carbapenemases; OXA: Oxacillinase; PER: Pseudomonas extended spectrum resistant; VEB: Vietnam extended spectrum beta-lactamase; CTX-M: Cefotaximase munich


Distribution of ESBL genes between inpatients and outpatients.

Typing of Isolates

RAPD typing was used to determine the degree of clonality among the ESBL producing E. coli isolates. The data revealed high diversity amongst all the species tested, with no identical RAPD patterns observed.

This suggests that the spread of resistance genes is underpinning the spread of resistance rather than expansion of a dominant clones.

Discussion

It is a fact that ESBLs production is the most common mechanism of E. coli resistance to third-generation cephalosporins among Enterobacteriaceae and it mediates multidrug resistance, as shown in this study. Phenotypic production of ESBLs was seen in 42.3% of isolates tested which were not closely related. This was considerably higher than other reports from similar studies from different parts of the world including different cities/regions of Nigeria where prevalences of ESBL production between 18.6% and 42% had been reported in Nigeria [8,10,11]. While outside Nigeria; in Benin, Tanzania, Mexico, Nepal and India ESBL report was between 31.3 and 38.7% [20-24]. But in Turkey and USA, ESBL productions were extremely higher 84.0% and 72% respectively [25,26]. The differences in prevalence may be multifaceted ranging from varying sample size, ESBL detection method, population dynamics, literacy, economic, socio-cultural or lack or inadequate antimicrobial stewardship. The presence of ESBL-producers in an individual is a key indicator to increased antibiotic resistance because plasmid carries multiple resistance genes including ESBL.

The prevalence of ESBL production in both inpatients and outpatients were 54.9% and 30.2%, respectively. This was similar to the report obtained in Iran; inpatients and outpatients were 53.0% and 41.0% respectively [27], while different from that of Bosnia-Herzegovina with ESBL prevalence in inpatients of 12.5% [28]. High level ESBL producing isolates were originally confined to inpatients the trajectory of paradigm shift is very high in outpatients and community. This shows the extent of spread and level of resistance in the region. The isolates from outpatient in this case can be regarded as community isolates because the patients were not admitted they only visited these hospitals for treatment which in most cases were brief period spent in the facility. The very high prevalence of ESBL in these hospitals particularly the level in outpatients is a worrisome development as several other reports have indicated overlap between community and nosocomial ESBL.

blaCTX-M variant were the most common observed in this study followed by blaVEB, blaOXA, blaSHV and blaPER. This is in line with other studies showing SHV and TEM families were gradually reducing in prevalence and being supplanted by the CTX-M family [19,29]. The CTX-M family has become widespread in both hospital and community settings virtually in every continents of the world [8,26]. blaCTX-M-15 was the dominant ESBL found among the blaCTX-M variants in accordance with previous reports all over the world [8,26,30]. blaCTX-M-15 has frequently been seen to co-exist with other ESBL genes in the isolates. blaVEB has been reported from most parts of the world since its first description in Vietnam [31] including south-western Nigeria [8,32]. To our knowledge, this was the first report of blaVEB and blaPER ESBLs from northern Nigeria. ESBLs production was found across varying clinical specimens and hospitals.

There was a high level of multidrug resistance to majority of the antibiotics including third-generation cephalosporins, ampicillin, beta-lactamase/inhibitor (amoxicillin-clavulanic acid), fluoroquinolones and aminoglycosides among the isolates. These findings have significant implications in the use of third-generation cephalosporins including fluroquinolones for the management of patients with infections caused by E. coli. In this panel only carbapenems retained good efficacy as a therapeutic option. The low rate of resistance to carbapenems was mirrored by a lack of detection of carbapenemase genes, the most likely scenario may be that carbapenem resistance is being caused by blaCTX-M-15 in conjunction with other mechanisms such as efflux and or porin loss. The absence of carbapenemase genes is very surprising compared to high resistance rates reported from different studies from Southern Nigeria [8,19]. Carbapenem resistance has been reported to be mediated by production of ESBL (largely CTX-M-15) accompanied by porin loss and or efflux activity [33]. The low resistance rate may not be unconnected with the high cost of carbapenem antibiotics which is directly related to the poverty and literacy level in the North of Nigeria in terms of affordability and awareness. Indiscriminate and empirical use of beta-lactam drugs in particular carbapenems should be avoided to guide against the development of carbapenem-resistant strains of E. coli leaving no viable therapeutic options in the future.

Limitation(s)

It was self-sponsored hence it was not possible to investigate further, for instance, confirm mechanisms of few isolates with carbapenem resistance with no carbapenemase genes.

Conclusion(s)

There is a significant challenge in the use of third-generation cephalosporins including other antibiotics except carbapenem in the management of patients with infections caused by E. coli in Nigeria, in the North of the country. This was threatened by widespread dissemination of CTX-M enzymes.

There is need for an effective antibiotic stewardship programme and regular antibiotic resistance surveillance studies enhanced by real time routine detection of ESBLs with a view to stemming the tide of antibiotic resistance and maintain low level resistance especially to carbapenems which remain critically important in this setting.

Numbers in parentheses are percentagesNumbers in parentheses are percentages

References

[1]Paterson DL, Bonomo RA, Extended-spectrum beta-lactamases: A clinical update Clin Microbiol Rev 2005 18(4):657-86.10.1128/CMR.18.4.657-686.200516223952  [Google Scholar]  [CrossRef]  [PubMed]

[2]World Health Organization. Global Action Plan on Antimicrobial Resistance. Geneva, Switzerland 2015  [Google Scholar]

[3]Williams DN, Antimicrobial resistance: Are we at the dawn of the post-antibiotic era? J R Coll Physicians Edinb 2016 46(3):150-56.10.4997/JRCPE.2016.30227959347  [Google Scholar]  [CrossRef]  [PubMed]

[4]Chaudhary U, Aggarwal R, Extended Spectrum Beta-Lactamases (ESBLs)-An emerging threat to clinical therapeutics Indian J Med Microbiol 2004 22(2):75-80.  [Google Scholar]

[5]Bradford PA, Extended-spectrum Beta-lactamases in the 21st Century: Characterization, epidemiology and detection of this important resistance threat Clin Microbiol Rev 2001 14(4):933-51.10.1128/CMR.14.4.933-951.200111585791  [Google Scholar]  [CrossRef]  [PubMed]

[6]Al-Jasser AM, Review Article: Extended Spectrum Beta-lactamases (ESBLs): A global problem Kuwait Med J 2006 38:171-85.  [Google Scholar]

[7]Ogbolu DO, Daini OA, Ogunledun A, Alli AO, Webber MA, High levels of multidrug resistance in clinical isolates of gram-negative pathogens from Nigeria Int J Antimicrob Agents 2011 37(1):62-66.10.1016/j.ijantimicag.2010.08.01921074376  [Google Scholar]  [CrossRef]  [PubMed]

[8]Ogbolu DO, Terry Alli OA, Webber MA, Oluremi AS, Omoboriowo MO, CTX-M-15 is established in most multi-drug resistant uropathogenic Enterobacteriaceae and Pseudomonaceae from hospitals in Nigeria Eur J Microbiol Immunol 2018 8(1):20-24.10.1556/1886.2017.0001229760961  [Google Scholar]  [CrossRef]  [PubMed]

[9]Iroha IR, Esimone CO, Neumann S, Marlinghaus L, Korte M, Szabados F, First description of Escherichia coli producing CTX-M-15- Extended Spectrum Beta Lactamase (ESBL) in out-patients from South-Eastern Nigeria Ann Clin Microbiol Antimicrob 2012 11(1):1910.1186/1476-0711-11-1922824236  [Google Scholar]  [CrossRef]  [PubMed]

[10]Mohammed Y, Gadzama GB, Zailani SB, Aboderin AO, Characterization of Extended-Spectrum Beta-lactamase from Escherichia coli and Klebsiella Species from North-Eastern Nigeria J Clin Diagn Res 2016 10(2):DC07-DC10.10.7860/JCDR/2016/16330.725427042460  [Google Scholar]  [CrossRef]  [PubMed]

[11]Onyedibe KI, Shebowale O, Okolo MO, Iroezindu MO, Afolaranmi TO, Nwaokorie FO, Low prevalence of carbapenem resistance in clinical isolates of Extended Spectrum Beta Lactamase (ESBL) producing Escherichia coli in North-Central, Nigeria Advances in Infectious Diseases 2018 8(3):109-120.10.4236/aid.2018.83011  [Google Scholar]  [CrossRef]

[12]Cochran WG, Sampling techniques 1963 2nd editionNew YorkJohn Wiley and Sons Inc.  [Google Scholar]

[13]Nsofor CA, Iroegbu CU, Antibiotic resistance profile of Escherichia coli isolated from five major geopolitical zones of Nigeria Journal of Bacteriology Research 2013 5(3):29-34.10.5897/JBR2012.035  [Google Scholar]  [CrossRef]

[14]Barrow GI, Feltham RKA, Characters of Gram-negative bacteria In: Cowan and Steel Manual for Identification of Medical Bacteria 1993 3rd editionCambridge University Press:94-164.10.1017/CBO9780511527104.013  [Google Scholar]  [CrossRef]

[15]Clinical and Laboratory Standards InstitutePerformance Standards for Antimicrobial Susceptibility Testing. 27th ed. CLSI supplement M100 Clinical and Laboratory Standards Institute 2017 950 West Valley Road, Suite 2500, Wayne, Pennsylvania 19087 USA  [Google Scholar]

[16]Kumarasamy KK, Toleman MA, Walsh TR, Bagaria J, Butt F, Balakrishnan R, Emergence of a new antibiotics resistance mechanisms in India, Pakistan and the U.K: A molecular, biological and epidemiological study Lancet Infect Dis 2010 10(9):597-602.10.1016/S1473-3099(10)70143-2  [Google Scholar]  [CrossRef]

[17]Swayne RI, Ludlam HA, Shet VG, Woodford N, Curran MD, Real time TaqMan PCR for rapid detection of genes encoding five types of non-metallo- (class A and D) carbapenemases in Enterobacteriaceae Int J Antimicrob Agents 2011 38(1):35-38.10.1016/j.ijantimicag.2011.03.01021549572  [Google Scholar]  [CrossRef]  [PubMed]

[18]Vogel I, Jones G, Triep S, Koek A, Dijkshoorn L, RAPD typing of Klebsiella pneumoniae, Klebsiella oxytoca, Serratia marcescens and Pseudomonas aeruginosa isolates using standardised reagents Clin Microbiol Infect 1999 5(5):270-76.10.1111/j.1469-0691.1999.tb00140.x11856266  [Google Scholar]  [CrossRef]  [PubMed]

[19]Ogbolu DO, Webber MA, High-level and novel mechanisms of carbapenem resistance in Gram-negative bacteria from tertiary hospitals in Nigeria Int J Antimicrob Agents 2014 43(5):412-17.10.1016/j.ijantimicag.2014.01.01424613608  [Google Scholar]  [CrossRef]  [PubMed]

[20]Anago E, Ayi-Fanou L, Akpovi CD, Hounkpe WB, Tchibozo MAD, Bankole HS, Antibiotic resistance and genotype of beta-lactamase producing Escherichia coli in nosocomial infections in Cotonou, Benin Ann Clin Microbiol Antimicrob 2015 14(5):01-06.10.1186/s12941-014-0061-125595314  [Google Scholar]  [CrossRef]  [PubMed]

[21]Moyo SJ, Aboud S, Kasubi M, Lyamuya EF, Maselle SY, Antimicrobial resistance among producers and non-producers of extended spectrum beta-lactamases in urinary isolates at a tertiary hospital in Tanzania BMC Res Notes 2010 3:34810.1186/1756-0500-3-34821184671  [Google Scholar]  [CrossRef]  [PubMed]

[22]Galindo-Mendez M, Molecular characterization and antimicrobial susceptibility pattern of extended-spectrum β-lactamase-producing Escherichia coli as cause of community acquired urinary tract infection Rev Chilena Infectol 2018 35(1):29-35.10.4067/s0716-1018201800010002929652969  [Google Scholar]  [CrossRef]  [PubMed]

[23]Ghimire A, Acharya B, Tuladhar R, Extended Spectrum β-Lactamase (ESBL) producing multidrug resistant gram-negative bacteria from various clinical specimens of patients visiting a tertiary care hospital TUJM 2017 4(1):01-08.10.3126/tujm.v4i0.21667  [Google Scholar]  [CrossRef]

[24]Kashyap G, Gupta S, Mamoria VP, Durlabhji P, Jain D, Increasing prevalence of Extended Spectrum Beta Lactamse (ESBL) producing E. coli and Klebsiella species in Outpatient Departments (OPDs) patients in urinary tract infections (UTIs) in a tertiary care hospital Int J Cur Res Rev 2013 05(11):87-93.  [Google Scholar]

[25]Bali EB, Açık L, Sultan N, Phenotypic and molecular characterization of SHV, TEM, CTX-M and extended-spectrum beta-lactamase produced by Escherichia coli, Acinobacter baumannii and Klebsiella isolates in a Turkish hospital Afr J Microbiol Res 2010 4(8):650-54.  [Google Scholar]

[26]Chandramohan L, Revell PA, Prevalence and molecular characterization of extended-spectrum-β-lactamase-producing Enterobacteriaceae in a pediatric patient population Antimicrob Agents Chemother 2012 56(9):4765-70.10.1128/AAC.00666-1222733062  [Google Scholar]  [CrossRef]  [PubMed]

[27]Hashemizadeh Z, Kalantar-Neyestanaki D, Mansouri S, Clonal relationships, antimicrobial susceptibilities and molecular characterization of extended-spectrum beta-lactamase-producing Escherichia coli isolates from urinary tract infections and fecal samples in Southeast Iran Rev Soc Bras Med Trop 2018 51(1):44-51.10.1590/0037-8682-0080-201729513841  [Google Scholar]  [CrossRef]  [PubMed]

[28]Ibrahimagić A, Uzunović S, Bedenić B, Prevalence of coexistence genes and clonal spread of ESBL-producing isolates causing hospital- and community-acquired infections in Zenica-Doboj Canton, Bosnia and Herzegovina J Health Sci 2017 7(2):80-90.10.17532/jhsci.2017.449  [Google Scholar]  [CrossRef]

[29]Tankhiwale SS, Jalgaonkar SV, Ahamad S, Hassani U, Evaluation of extended spectrum beta lactamase in urinary isolates Indian J Med Res 2004 120(6):553-56.  [Google Scholar]

[30]Djuikoue IC, Woerther PL, Toukam M, Burdet C, Ruppé E, Gonsu KH, Intestinal carriage of extended spectrum beta-lactamase producing Escherichia coli in women with urinary tract infections, Cameroon J Infect Dev Ctries 2016 10(10):1135-39.10.3855/jidc.761627801378  [Google Scholar]  [CrossRef]  [PubMed]

[31]Naas T, Benaoudia F, Massuard S, Nordmann P, Integron located VEB1- Extended spectrum beta-lactamase in a proteus mirabilis clinical isolates from Vietnam J Antimicrob Chemother 2000 46(5):703-11.10.1093/jac/46.5.70311062188  [Google Scholar]  [CrossRef]  [PubMed]

[32]Aibinu I, Pfeifer Y, Ogunsola FTI, Odugbemi T, Koenig W, Ghebremedhin B, Emergence of beta-lactamases OXA-10, VEB-1 and CMY in Providentia spp. from Nigeria J Antimicrob Chemother 2011 66(8):1931-32.10.1093/jac/dkr19721609982  [Google Scholar]  [CrossRef]  [PubMed]

[33]Ogbolu DO, Webber MA, Carbapenem resistance in nigerian gram Negative bacteria: The role of extended-spectrum β-lactamase CTX-M-15 West Indian Med J 2018 67(4):344-49.10.7727/wimj.2017.122  [Google Scholar]  [CrossRef]