Genetics Section DOI : 10.7860/JCDR/2017/25374.10890
Year : 2017 | Month : Nov | Volume : 11 | Issue : 11 Page : GC01 - GC04

Association of Lin-28A rs3811464 Variant with Susceptibility to Type 2 Diabetes

Mona Khodabandeh1, Hamid Ghaedi2, Behnam Alipoor3, Taghi Golmohammadi4

1 Postgraduate Student, Department of Cell and Molecular Biology, Faculty of Biological Sciences, Kharazmi University, Tehran, Iran.
2 Assistant Professor, Department of Medical Genetics, Faculty of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran.
3 Assistant Professor, Department of Laboratory Sciences, Faculty of Paramedicine, Yasuj University of Medical Sciences, Yasuj, Iran.
4 Associate Professor, Department of Biochemistry, School of Medicine, Tehran University of Medical Sciences, Tehran, Iran.


NAME, ADDRESS, E-MAIL ID OF THE CORRESPONDING AUTHOR: Dr. Taghi Golmohammadi, Associate Professor, Department of Biochemistry, Faculty of Medicine, School of Medicine, Tehran University of Medical Sciences, Tehran-1417653761, Iran.
E-mail: golmoham@sina.tums.ac.ir
Abstract

Introduction

It has been suggested that Lin-28A and the let-7 microRNA family (Lin-28/let-7 axis) play a critical role in the control of glucose metabolism, insulin sensitivity and resistance to diabetes.

Aim

This case-control study aimed at evaluating the association between Lin-28 rs3811464 polymorphism and the susceptibility to Type 2 Diabetes (T2D) in a sample of Iranian population.

Materials and Methods

This study involved 172 T2D patients and 160 non-diabetic age and gender-matched controls. Lin 28A rs3811464 genotypes were determined by Polymerase Chain Reaction–Restriction Fragment Length Polymorphism (PCR-RFLP) technique.

Results

The results showed that the frequency of the AA genotype was significantly higher in control subjects than in diabetic patients (13.12% vs. 4.65%). In addition, binary logistic regression analysis revealed that rs3811464-AA genotype was significantly associated to T2D after adjustment for BMI, age and lipid profiles. Indeed, subjects with AA genotype were less likely to develop T2D than GG and AG subjects (OR of 0.26, 95% CI 0.10-0.66, p=0.005).

Conclusion

The findings of our study suggest that the Lin 28A rs3811464 is associated with type 2 diabetes susceptibility and subjects with AA genotypes were less likely to develop T2D diabetes.

How to cite this article

Mona Khodabandeh, Hamid Ghaedi, Behnam Alipoor, Taghi Golmohammadi, .ASSOCIATION OF LIN-28A RS3811464 VARIANT WITH SUSCEPTIBILITY TO TYPE 2 DIABETES.Journal of Clinical and Diagnostic Research [serial online]2017 Nov[cited:2019 May 23] 11 GC01 - GC04
 Available from
http://www.jcdr.net//back_issues.asp

Introduction

Diabetes mellitus is a major global health problem which imposes a huge economic burden on societies [1]. It has been shown that in 2013, 382 million people had diabetes and it is expected to rise to 592 million by 2035 [2]. Type 2 Diabetes (T2D) is the most common form of diabetes which is characterized by chronic hyperglycaemia due to defects in insulin secretion or its action [3,4]. As a metabolic disorder, T2D leads to various complications such as cardiovascular disorders, retinopathy and nephropathy and thereby causes high rate of morbidity, disability and mortality worldwide [5,6]. T2D is a multifactorial disease resulting from a complex interaction between genetic and environmental factors [6]. Many studies identified different loci implicated in the genetic predisposition to T2D, but the genetics of T2D remained to be elusive and not well understood [7,8].

Lin-28 (including Lin-28A and Lin-28B) is an evolutionarily conserved RNA-binding protein that plays key roles in multiple cellular developmental processes [9,10]. New studies suggested that Lin-28A and its homolog Lin-28B and the let-7 microRNA family (Lin-28/let-7 axis) play a direct role in the regulation of glucose metabolism [9,11,12]. Zhu H et al., in a study showed that Lin-28A in transgenic mouse model exhibited enhanced glucose uptake in peripheral tissues. Indeed their findings revealed that Lin-28A overexpression results in insulin sensitivity, enhanced glucose tolerance, and resistance to diabetes [11]. Moreover, conditional deletion of Lin-28A in skeletal muscles lead to insulin resistance and impaired glucose uptake, suggesting that Lin-28 is physiologically required for normal glucose homeostasis [12]. Zhu H et al., also showed that in contrast to the phenotypes seen in Lin-28A transgenic mouse model, inducible let-7 transgenic mice have hyperglycaemia and glucose intolerance. These findings imply that Lin-28 may increase glucose uptake by suppressing let-7 [12].

It has been suggested that Single Nucleotide Polymorphisms (SNPs) in let-7/Lin-28 axis could affect the interaction of let-7 and Lin-28 and result in more susceptibility to diseases [13-16]. Chen AX et al., reported that rs3811463 polymorphism could lead to differential regulation of Lin-28 by let-7 and have a significant effect on the risk of breast cancer. They showed that the C allele of rs3811463 weakened let-7–induced repression of Lin-28 mRNA, resulting in increased production of Lin-28 protein [13]. However, they did not found a significant association between rs3811464 and breast cancer in a sample of Chinese population. The rs3811464 is located in the promoter region of Lin-28 that is 126 bp upstream of the transcriptional start site [13]. Till date only one study has investigated the association of this polymorphism with T2D susceptibility which failed to find differences in the frequencies of rs3811464 genotypes between diabetic patients and control subjects [17].

Considering the important role of the Lin-28 in the insulin and glucose metabolism and also the impact of SNPs on the Lin-28 expression and function, in this case-control study we aimed to investigate the possible association between the Lin-28A rs3811464 polymorphism with the susceptibility to T2D in a sample of Iranian population.

Materials and Methods

This case-control study was conducted from March 2016 to November 2016 and involved 172 T2D patients and 160 non-diabetic age and gender-matched controls. All subjects were recruited from Shahid Taleghani hospital (Tehran, Iran). Diabetes is defined as Fasting Blood Sugar (FBS) ≥126 mg/dL and two hours glucose ≥200 mg/dL. The control group was chosen among the healthy subjects without a family history of diabetes who had FBS level of <100 mg/dL and Haemoglobin A1c (HbA1C) <5.7%. Individuals with type 1 diabetes mellitus, cardiovascular disorders, renal and hepatic diseases and patients with any malignancies were excluded from the study. The study was approved by the Ethical Committee of Shahid Beheshti University of Medical Sciences and written informed consent was obtained from all subjects before enrollment in the study. Demographic characteristics of study population were collected by interviewer-administered questionnaire and the medical records.

Biochemical Measurements

Total cholesterol, triglyceride, HDL–cholesterol, and FBS levels were measured using the routine laboratory methods. LDL-cholesterol was calculated using the Friedewald equation. Moreover, HbA1C level was evaluated by high performance liquid chromatography method.

DNA Extraction and Genotyping

Genomic DNA was isolated from the whole blood samples by salting out method.

Lin-28A rs3811464 genotypes were determined by PCR-RFLP technique. PCR amplification was carried out using the following primers: forward 5’- AGGCAAAGGGTTGGTTCGG -3’ and reverse 5’- CACCTGTATCTGCTTTGGGGAC -3’. The thermal cycling conditions were as follows: 94°C for 5 minutes followed by 30 cycles comprising of 95°C for 40 seconds, annealing time at 61°C for 40 seconds and extension at 72°C for 40 seconds with a final extension time of seven minutes at 72°C. The PCR product (368bp) was digested with 10 units of NlaIV restriction enzyme and then the fragments were separated on a SYBR Green stained 3% agarose gel. The A allele produced 264 bp and the G allele yielded 175 and 89 bp fragments after digestion. While the heterozygous AG was characterized by three bands of 264, 175 and 89 bp [Table/Fig-1]. All genotypes produced 64, 21 and 19 bp bands after digestion. Fragments smaller than 50 bp were not visualized [Table/Fig-1].

PCR-RFLP based genotypes of Lin-28A rs3811464 variant.

Bioinformatic Analysis

For further investigation, the rs3811464 variant was analyzed in the genomics context. A Multiple Sequence Alignment (MSA) performed to assess the sequence conservation [18]. Moreover, the haplotype blocks and SNPs in strong Linkage Disequilibrium (LD) were obtained from HaploReg v4 [19]. To more dissect the effect of rs3811464 different alleles on Lin-28-3’UTR secondary structure, the Srna software was used to calculate partition function for sampling 1000 Boltzmann ensemble structures and clustering of Lin-28-3’UTR secondary structure with alternative and wild-type alleles [20].

Statistical Analysis

All statistical analysis was done by Statistical Software Package (SPSS) version 18.0. The continuous and categorical variables were expressed as mean ± SD and percentages (n), respectively. Student’s t-test was used to compare the quantitative variables. Compatibility of genotype frequencies with Hardy–Weinberg equilibrium expectations and comparisons of the categorical variables were evaluated by chi-square test. Independent Odds Ratio (OR) and its 95% confidence interval (CI) were calculated using unconditional binary logistic regression after adjusting for the confounders of age, BMI and lipid levels. A p-value <0.05 were considered to be statistically significant.

Results

Characteristics of the Study Population

Clinical and biochemical characteristics of total 332 subjects are summarized in [Table/Fig-2].

Clinical characteristic of the T2D patients and control subjects.

ParameterControl subjects(n = 160)T2D(n = 172)p-value
Age (years)53.06±6.6254.46±8.810.103
Sex (Male/Female)78/8290/820.58
BMI (kg/m2)27.56±3.9329.26±4.37<0.001
Systolic blood pressure (mmHg)124.05±17.96128.76±19.730.023
Diastolic blood pressure (mmHg)75.88±11.3479.44±15.330.017
Fasting plasma glucose (mg/dL)86.49±8.76140.51±35.47<0.001
HbA1C%5.36±0.377.62±1.04<0.001
Total cholesterol (mg/dL)160.50±44.87168.30±38.920.090
Triglyceride (mg/dL)138.35±71.08158.91±76.340.011
HDL-C (mg/dL)43.87±10.2041.55±9.360.031
LDL-C (mg/dL)87.59±21.5888.36±26.930.774

There were no significant differences between groups for age and sex. T2D patients had significantly higher values for BMI (p<0.001), systolic blood pressure (p=0.023), diastolic blood pressure (p=0.017), triglycerides (p=0.011), FBS (p<0.001), HbA1C (p<0.001) and lower level of HDL (p=0.031) than the control subjects. Moreover, there was no statistically significant difference between T2D and normal subjects for LDL (p=0.774) and total cholesterol levels (p=0.09).

Association of rs3811464 variant with susceptibility to T2D: genotype distribution and allele frequency of the rs3811464 variant in T2D patients and control subjects are shown in [Table/Fig-3]. The genotype distributions in the study population was compatible with Hardy–Weinberg equilibrium (p>0.05).

Genotype distribution and allele frequency rs3811464 polymorphism.

GenotypesControl subjects(n=160)T2D(n=172)p-valueOR (95% CI)
Co-dominant
GG55 (34.37%)64 (37.2%)0.024
AG84 (52.5%)100 (58.13%)
AA21 (13.12%)8 (4.6%)
Dominant model
AG+AA105 (65.62%)108 (62.79%)0.590.88 (0.56-1.38)
GG55 (34.38%)64 (37.21%)
Recessive model
GG+AG139 (86.88)164 (95.35%)0.0060.32 (0.13-0.75)
AA21 (13.12%)8 (4.65%)
Over-dominant model
GG+AA76 (47.5)72 (41.86%)0.300.79 (0.51-1.22)
AG84 (52.5%)100 (58.14%)
Allele
G194 (60.63%)228 (66.27%)0.141.27 (0.93-1.75)
A126 (39.37%)116 (33.73%

Although the A allele was more observed among the control subjects, rs3811464 allele distribution was not significant between the groups (p=0.14). The genotype frequencies of the rs3811464 polymorphism was differently distributed between T2D and control subjects (p=0.02). Our results showed that the frequency of the AA genotype was significantly higher in control subjects than in T2D patients (13.12% vs. 4.65%). In addition, dominant, recessive and over-dominant models of inheritance were evaluated. The results showed that the rs2910164 variant was protective against T2D under recessive model [Table/Fig-3]. Binary logistic regression analysis was done to evaluate the independent association of rs3811464 variant with T2D. Our analysis revealed that rs3811464-AA genotype was significantly associated to T2D after adjustment for BMI, age and lipid profiles [Table/Fig-4]. Indeed, subjects with AA genotype were less likely to develop T2D than GG and AG subjects (OR of 0.26, 95% CI 0.10-0.66, p=0.005).

Logistic regression analysis of variables associated with the risk of T2D.

Parameterp-valueOR95% CI
Age0.0771.027(0.997-1.05)
BMI0.0011.100(1.038-1.16)
Triglyceride0.1271.003(0.999-1.00)
Total cholesterol0.1611.005(0.998-1.01)
LDL-C0.2670.993(0.982-1.00)
rs3811464-AA0.0050.26(0.10-0.66)

BMI: body mass index; LDL-C: Low-density lipoprotein cholesterol; CI: confidence interval; OR: Odds ratio. Type 2 diabetes was considered as dependent variable.


Bioinformatic Analyses Results

MSA analysis showed that rs3811464 variant is well conserved among the selected primates [Table/Fig-5]. The HaploReg analyses revealed several correlated polymorphism in strong LD (r2>0.9) in Asian (ASN) and European (EUR) population from the 1000 Genomes Project with rs2910164 variant [Table/Fig-6]. We draw 1000 samples from the ensemble of secondary structures of Lin-28-3’UTR in proportion to Boltzmann weights for the A and the G alleles of rs3811464. As illustrated by Multi Dimensional Scaling (MSD) plots, the 3’UTR conform two distinct clusters with A allele and four distinct clusters in the case of G allele [Table/Fig-7]. This result indicates the structural effects of rs2910164 on the host gene secondary structure.

Multiple sequence alignment for Lin-28A rs3811464 variant and flanking sequence. The asterisks denote conserved nucleotides.

Polymorphisms linked to rs3811464 variant in HaploReg.

VariantLD(r2)Proteins boundMotifs changedGENCODE genes
rs127447850.91-Ets,Mrg,Tgif112kb 5’ of LIN-28A
rs124023570.91-AhR::Arnt,Arnt11kb 5’ of LIN-28A
rs112479480.94-4 altered motifs11kb 5’ of LIN-28A
rs112479490.96-11 altered motifs11kb 5’ of LIN-28A
rs75565000.97-4 altered motifs7.7kb 5’ of LIN-28A
rs115775350.95GATA321 altered motifs6.1kb 5’ of LIN-28A
rs75132730.95FOXA110 altered motifs5.9kb 5’ of LIN-28A
rs75178770.92CJUN5 altered motifs5.5kb 5’ of LIN-28A
rs75496840.94CJUN-5.5kb 5’ of LIN-28A
rs75520600.95CJUN-5.3kb 5’ of LIN-28A
rs112479520.94-Nkx2, Nkx3, SETDB15.2kb 5’ of LIN-28A
rs112479530.95-18 altered motifs5kb 5’ of LIN-28A
rs66696700.95-Mtf13.7kb 5’ of LIN-28A
rs127598530.94-4 altered motifs3.6kb 5’ of LIN-28A
rs353476950.93--2.4kb 5’ of LIN-28A
rs75301140.98BAF170, BRG1, NRSFIk-1,ZBTB7A2.2kb 5’ of LIN-28A
rs127474260.96-BDP1,HDAC21.6kb 5’ of LIN-28A
rs121227030.96MAX9 altered motifs1.5kb 5’ of LIN-28A
rs38114641-5 altered motifs125bp 5’ of LIN-28A

The secondary structures of Lin-28-3’UTR. a,b) depicts the Lin-28-3’UTR centroid structures and MSD plots of the structural ensemble with A and G allele, respectively.

Discussion

In our knowledge, this is the first case-control study which evaluates the association between Lin-28A rs3811464 polymorphism and the susceptibility to T2D in a sample of Iranian population. The finding of our study shows that the AA genotype frequency was significantly higher in control subjects than in T2D patients. Indeed, our results emphasize that subjects with AA genotype were less likely to develop T2D than GG and AG subjects. This finding is not in agreement with the results of Zhang J et al., study in the Han population which failed to find significant differences in the frequencies of rs3811464 genotypes between diabetic patients and control subjects [17]. One possible reason for such inconsistency can be explained by the genetic differences between Iranian and China populations and also in the study sample size.

Emerging evidence has reported that Lin-28 plays a critical role in the control of glucose metabolism, insulin sensitivity and resistance to diabetes. Zhu H et al., reported that the Lin-28A transgenic mice showed enhanced glucose uptake and lower fed state glucose. In addition they revealed that, shRNA knockdown of Lin-28A in C2C12 led to a reduction in labeled glucose uptake [11]. Similarly, Zhu H et al., in another study showed that Lin-28A transgenic mice cleared glucose more efficiently during glucose and insulin tolerance testing. In addition, it has been shown that glucose hemostasis would be impaired in mice with muscle-specific Lin-28A knock-out and inducible let-7 [12]. Taken together, their results demonstrated that Lin-28 may increases glucose uptake by suppressing let-7. Shinoda G et al., reported that Lin-28A and Lin-28-B deficiency in knockout mice led to growth defects and aberrations in glucose metabolism [21].

Due to the important role of the Lin-28/let-7 axis in the regulation of glucose metabolism, genetic variation in Lin-28 could affect the interaction of let-7 and Lin-28 and result in more susceptibility to diseases. For example, the allelic variants of rs3811463 could alter the local mRNA secondary structure including that of the let-7 binding site [13]. Chen AX et al., identified a SNP, rs3811464, in the promoter region of Lin-28 that was 126 bp upstream of the transcriptional start site of Lin-28 [13]. In contrast with the results of Zhang J et al., our results emphasize that subjects with rs3811464-AA genotype were less likely to develop T2D [17]. This polymorphism was not located near the binding sites of miRNAs targeting Lin-28 such as Let-7. Therefore, other regulatory mechanisms may contribute to the impact of Lin-28 rs3811464 on the regulation of let-7/Lin-28 loop and development of T2D disease. For example, because the rs3811464 is located in the 59 flanking region (promoter) of the Lin-28 gene, allele of this variation could lead to alternation of the transcriptional factor binding site. Further functional studies will be necessary to obtain a deeper comprehension about rs3811464 association with diabetes.

Our bioinformatics analyses also provide more evidence on the association of rs3811464 variant with T2D susceptibility. MSA analysis showed that the rs3811464 variant and flanking sequence is conserved across primate taxa. Study reported that SNPs within conserved DNA regions could pursue phenotypic consequences [22]. In addition, it is widely accepted that region-based analysis has several advantages than single-SNP analysis to identify disease-associated loci [23]. Our result identified several correlated polymorphism in strong LD with the rs2910164 polymorphism. Further investigations into the LD relationships between different variants in different parts of the genome could enhance the ability to identify association with a disease phenotype [24]. Moreover, modeling secondary structure of Lin-28-3’UTR in the presence of rs3811464 different allele revealed that, changing from A to G changed the energy of secondary structures markedly. Such SNP-mediated changes in secondary structure may elicit functional consequences.

Limitation

As a limitation our study suffers from limited sample size, multicenter and additional studies with a larger sample size will be necessary to confirm the association of these variant with T2D susceptibility.

Conclusion

The results of our study suggest that the Lin-28A rs3811464 is associated with T2D susceptibility and subjects with AA genotype were less likely to develop T2D.

References

References[1]Dall TM, Yang W, Halder P, Pang B, Massoudi M, Wintfeld N, The economic burden of elevated blood glucose levels in 2012: diagnosed and undiagnosed diabetes, gestational diabetes mellitus, and prediabetes Diabetes Care 2014 37(12):3172-79.

[2]Guariguata L, Whiting D, Hambleton I, Beagley J, Linnenkamp U, Shaw J, Global estimates of diabetes prevalence for 2013 and projections for 2035 Diabetes Research And Clinical Practice 2014 103(2):137-49.

[3]Khodabandehloo H, Gorgani-Firuzjaee S, Panahi G, Meshkani R, Molecular and cellular mechanisms linking inflammation to insulin resistance and β-cell dysfunction Translational Research 2016 167(1):228-56.

[4]Tripathy D, Chavez AO, Defects in insulin secretion and action in the pathogenesis of type 2 diabetes mellitus Current Diabetes Reports 2010 10(3):184-91.

[5]McClelland AD, Kantharidis P, MicroRNA in the development of diabetic complications Clinical Science 2014 126(2):95-110.

[6]Ahlqvist E, Van Zuydam NR, Groop LC, McCarthy MI, The genetics of diabetic complications Nature Reviews Nephrology 2015 11(5):277-87.

[7]Alipoor B, Meshkani R, Ghaedi H, Sharifi Z, Panahi G, Golmohammadi T, Association of miR-146a rs2910164 and miR-149 rs2292832 Variants with Susceptibility to Type 2 Diabetes Clinical Laboratory 2016 62(8):1553-61.

[8]Ghaedi H, Tabasinezhad M, Alipoor B, Shokri F, Movafagh A, Mirfakhraie R, The pre-mir-27a variant rs895819 may contribute to type 2 diabetes mellitus susceptibility in an Iranian cohort Journal Of Endocrinological Investigation 2016 39(10):1187-93.

[9]Nguyen LH, Zhu H, Lin28 and let-7 in cell metabolism and cancer Translational Paediatrics 2015 4(1):4

[10]Jiang S, Baltimore D, RNA-binding protein Lin28 in cancer and immunity Cancer Letters 2016 375(1):108-13.

[11]Zhu H, Shah S, Shyh-Chang N, Shinoda G, Einhorn WS, Viswanathan SR, Lin28a transgenic mice manifest size and puberty phenotypes identified in human genetic association studies Nature Genetics 2010 42(7):626-30.

[12]Zhu H, Shyh-Chang N, Segrè AV, Shinoda G, Shah SP, Einhorn WS, The Lin28/let-7 axis regulates glucose metabolism Cell 2011 147(1):81-94.

[13]Chen AX, Yu KD, Fan L, Li JY, Yang C, Huang AJ, Germline genetic variants disturbing the Let-7/LIN28 double-negative feedback loop alter breast cancer susceptibility PLoS Genet 2011 7(9):e1002259

[14]Zhang Y, Wang R, Miao L, Jiang H, Yuan H, Ma H, Genetic variants in let-7/Lin28 modulate the risk of oral cavity cancer in a Chinese Han population Scientific Reports 2014 :4

[15]Wen J, Liu H, Wang Q, Liu Z, Li Y, Xiong H, Genetic variants of the LIN28B gene predict severe radiation pneumonitis in patients with non-small cell lung cancer treated with definitive radiation therapy European Journal of Cancer 2014 50(10):1706-16.

[16]Ye Y, Madison B, Wu X, Rustgi AK, A LIN28B polymorphism predicts for colon cancer survival Cancer Biology & Therapy 2012 13(14):1390-95.

[17]Zhang J, Zhang L, Fan R, Guo N, Xiong C, Wang L, The polymorphism in the let-7 targeted region of the Lin28 gene is associated with increased risk of type 2 diabetes mellitus Molecular and Cellular Endocrinology 2013 375(1):53-57.

[18]Sievers F, Higgins DG, Clustal Omega, accurate alignment of very large numbers of sequences Multiple Sequence Alignment Methods 2014 :105-16.

[19]Ward LD, Kellis M, HaploReg v4: systematic mining of putative causal variants, cell types, regulators and target genes for human complex traits and disease Nucleic Acids Research 2016 44(D1):D877-D81.

[20]Ding Y, Chan CY, Lawrence CE, RNA secondary structure prediction by centroids in a Boltzmann weighted ensemble RNA 2005 11(8):1157-66.

[21]Shinoda G, Shyh-Chang N, Soysa T, Zhu H, Seligson MT, Shah SP, Fetal deficiency of Lin28 programs life-long aberrations in growth and glucose metabolism Stem Cells 2013 31(8):1563-73.

[22]McCauley JL, Kenealy SJ, Margulies EH, Schnetz-Boutaud N, Gregory SG, Hauser SL, SNPs in Multi-species Conserved Sequences (MCS) as useful markers in association studies: a practical approach BMC Genomics 2007 8(1):266

[23]Ridolfi E, Fenoglio C, Cantoni C, Calvi A, De Riz M, Pietroboni A, Expression and genetic analysis of microRNAs involved in multiple sclerosis International Journal of Molecular Sciences 2013 14(3):4375-84.

[24]North B, Curtis D, Martin E, Lai E, Roses A, Sham P, Further investigation of linkage disequilibrium SNPs and their ability to identify associated susceptibility loci Annals of Human Genetics 2004 68(3):240-48.