JCDR - Register at Journal of Clinical and Diagnostic Research
Journal of Clinical and Diagnostic Research, ISSN - 0973 - 709X
Microbiology Section DOI : 10.7860/JCDR/2017/25988.10548
Year : 2017 | Month : Sep | Volume : 11 | Issue : 9 Full Version Page : DC01 - DC05

Characterization of Vancomycin Resistant Enterococci in Hospitalized Patients and Role of Gut Colonization

Geetarani Purohit1, Rajni Gaind2, Reetika Dawar3, P.K. Verma4, K.C. Aggarwal5, Raman Sardana6, Monorama Deb7

1 Senior Resident, Department of Microbiology, VMMC and Safdarjung Hospital, New Delhi, India.
2 Professor and Head, Department of Microbiology, VMMC and Safdarjung Hospital, New Delhi, India.
3 Senior Consultant, Department of Microbiology, Apollo Hospital, New Delhi, India.
4 Professor, Department of Anaesthesia, VMMC and Safdarjung Hospital, New Delhi, India.
5 Professor and Head, Department of Paediatrics, VMMC and Safdarjung Hospital, New Delhi, India.
6 Senior Consultant, Department of Microbiology, Apollo Hospital, New Delhi, India.
7 Director Professor, Department of Microbiology, VMMC and Safdarjung Hospital, New Delhi, India.


NAME, ADDRESS, E-MAIL ID OF THE CORRESPONDING AUTHOR: Dr. Rajni Gaind, Professor and Head, Department of Microbiology, VMMC and Safdarjung Hospital, New Delhi-110029, India.
E-mail: rgaind5@hotmail.com
Abstract

Introduction

Enterococci are part of the normal intestinal flora and have been recognized as important human pathogens. Vancomycin Resistant Enterococci (VRE) are global threat as this resistance is transmissible and also poses a challenge for infection control.

Aim

This study was undertaken to study phenotypic and genotypic characteristics of VRE from clinically significant infections among hospitalized patients and their association with gut colonization.

Materials and Methods

Clinically significant isolates of enterococci (n=250) were studied. Species confirmation was done by Polymerase Chain Reaction (PCR). Minimum Inhibitory Concentration (MIC) for vancomycin was determined by E-test. PCR for VanA, VanB and VanC1 gene was done for genotypic characterization. MIC for teicoplanin, linezolid, tigecycline, daptomycin and quinupristin-dalfopristin was determined by E test. Patients with VRE infection were screened for gut colonization using vancomycin screen agar (6 μg/mL). Continuous data was analysed using the Student’s t-test. Categorical data was assessed using Pearson’s Chi-square test. A value of p ≤ 0.05 was considered statistically significant.

Results

There was good correlation between the phenotypic and genotypic methods used for species identification and detection of vancomycin resistance. E. faecium (162, 64.8%) was most common followed by E. faecalis (82, 32.84%) and E. gallinarum (6, 2.4%). Overall higher resistance was observed among E. faecium. Vancomycin MIC ≥ 2 μg/mL was noted in 63 (25.2%) isolates. Fifty seven isolates showed presence of vanA and vanC1 was detected in six isolates of E. gallinarum. Isolates with VanB genotype was not detected in the present study. MIC50 (μg/mL) for teicoplanin, linezolid, tigecycline, daptomycin and quinupristin-dalfopristrin was 24, 0.75, 0.064, 2 and 0.064 respectively. Resistance to linezolid (1, 1.6%) and tigecycline (2, 3.2%) was rare. Majority (33/47, 70.2%) patients with clinically significant VRE infection showed gut colonization.

Conclusion

Vancomycin resistance among enterococci is emerging. Emergence of tigecycline and linezolid resistance is also posing a challenge for clinicians. Thus, further investigations are warranted to control vancomycin resistance among pathogens.

Keywords

Linezolid, Surgery, Urine, VanA, VanB

Introduction

The members of genus Enterococcus, part of normal gastrointestinal flora, have emerged as one of the major causes of nosocomial infections [1]. Enterococci are most common cause of urinary tract infections, second most common cause of intra-abdominal and intra-pelvic abscesses or post-surgery wound infections and third most common cause of blood stream infections [2]. Similar published reports are available in Indian literature [3]. According to the National Nosocomial Infections Surveillance (NNIS) data, more than 28% of all nosocomial enterococci strains are vancomycin resistant in United States [4].

The mechanisms of antibiotic resistance in enterococci are by mutation and horizontal gene transfer mediated via plasmids and transposons [5]. Glycopeptide resistance is mediated by different Vancomycin resistance (Van) gene operons namely VanA, VanB, VanC, VanD, VanE, VanG, VanL, VanM and VanN. Out of these VanA is most common followed by VanB and VanC is responsible for the intrinsic resistance present in E. gallinarum and E. casseliflavus [6].

Vancomycin predisposes patients to colonization and infection with VRE by inhibiting growth of normal Gram-positive bowel flora and by providing advantage for VRE that may be present in small numbers in an individual’s bowel [4]. The primary sites of colonisation in the hospitalised patients are gastrointestinal tract, skin and soft tissues. The present study was carried out for identification of species, antimicrobial resistance pattern and genotypic characterization of VRE isolates from clinically significant infections in hospitalized patients and their association with gut colonization.

Materials and Methods

This cross-sectional descriptive study was carried out over a period of one and half years during October 2013 to April 2015 at the Department of Microbiology, Vardhman Mahavir Medical College and Safdarjung Hospital, New Delhi, India. A total of 4200 samples (pus, blood and urine) received from hospitalized patients were processed according to standard protocols [7]. Patients positive for enterococci isolates were included in this study. Patients positive for VRE isolates were assessed for gut colonization by inoculating fecal sample onto vancomycin screen agar. The study protocol was approved by the Institutional Ethical Committee (IEC/Nov 13/98).

Inclusion Criteria

Clinically significant enterococci isolated from pus, blood and urine samples from hospitalized patients.

Exclusion Criteria

Enterococci isolates from samples collected from patients presenting at the outpatient department.

A total of 250 non-duplicate clinically significant enterococci isolates were included in the study. The isolates were identified by their colony morphology, catalase reaction, growth on bile esculin agar, tolerance to 6.5% NaCl, growth at 10°C and 45°C. Species identification was carried out by a battery of biochemical tests; carbohydrate fermentation tests (mannitol, arabinose, sucrose, sorbitol, lactose and raffinose), reduction of potassium tellurite, arginine hydrolysis tests, motility and pigment production [8]. E. faecalis and E. faecium were confirmed by PCR using specific primers and controls [Table/Fig-1]. The unidentified species were confirmed by Vitek 2 system (bioMeriux, USA). The antibiotics tested were ampicillin (10 μg), ciprofloxacin (5 μg), high content gentamycin (120 μg), vancomycin (30 μg), teicoplanin (30 μg), linezolid (30 μg), and tigecycline (15 μg). In addition, nitrofurantoin (300 μg) and norfloxacin (10 μg) were included for urinary isolates.

a) Agarose gel electrophoresis of the amplified products by PCR for E. faecium (658 bp). Ladder – 100 bp DNA ladder, S1, S2 – sample; PC- Enterococcus faecium ATCC® 19434 TM was used as positive control; NC- Mili-Q water was used as negative control; b) Agarose gel electrophoresis of the amplified products by PCR for E. faecalis (941 bp). Ladder - 100 bp DNA ladder; S1, S2, S3- sample; PC- Enterococcus faecalis ATCC® 29212 TM was used as positive control; Mili-Q water was used as Negative Control (NC).

Screening for presence of VRE was carried out by agar dilution method. About 10 μL of bacterial inoculums (0.5 McFarland turbidity standards) were spot inoculated onto the Mueller Hinton Agar (MHA) plates with different concentrations (0.25-32 μg/mL) of vancomycin (HiMedia, Mumbai) and incubated at 37°C for 24 hours. Growth of more than one colony was considered positive [9]. Finally, MIC was confirmed by E test (bioMeriux, France).

All isolates with vancomycin MIC ≥ 2 μg/mL were tested against teicoplanin, linezolid, tigecycline, quinupristin-dalfopristin and daptomycin by E-test. Antibiotic susceptibility results were interpreted according to CLSI 2012 guidelines [9]. The European Committee on Antimicrobial Susceptibility Testing guidelines (EUCAST- 2012; www.eucast.org) were used for tigecycline [10].

Genotypic Characterization of Vancomycin Resistance Genes

Strains were inoculated in Luria-Bertani broth (1% tryptone, 0.5% yeast extract, 0.5% NaCl), incubated overnight aerobically at 37°C and DNA was extracted by phenol chloroform method as described by Sambrook J et al., [11].

PCR reaction was performed in a thermocycler (Eppendorf, USA). Briefly initial denaturation at 94°C for five minutes followed by 30 cycles of denaturation at 94°C for one minute, annealing temperature (differs according to the genes) for one minute, amplification at 72°C for one minute for 30 cycles and final extension at 72°C for 10 minutes. PCR assay was carried out in sterile 0.2/0.5 mL PCR tubes with 25 μL reaction volume. Each 25 μL reaction mixture contained 2.5 μL 10X PCR buffer, 2.5 μL 1.5 mmol MgCl2, 2 μL 0.2 mmol dNTPmix, 0.5 μL of 10 pmol each of forward and reverse primers, 0.2 μL Taq DNA polymerase (1 unit/reaction) and sterile double distilled water to make the final volume. Primers used in the study are described in [Table/Fig-2].

Details of primers used in the study.

GenesAmplicon size (bp)Primers
VanA732FP 5’ GGGAAAACGACAATTGC 3’RP 5’ GTACAATGCGGCCGTTA 3’
VanB536FP 5’ AAGCTATGCAAGAAGCCATG 3’RP 5’ CCGACAATCAAATCATCCTC 3’
VanC1822FP 5’ TGGTATCAAGGAAACCTCGC 3’RP 5’ CCGACTTCCGCCATCATAGCTG 3’
E. faecalis941FP 5’ ATCAAGTACAGTTAGTCT 3’RP 5’ ACGATTCAAAGCTAACTG 3’
E. faecium658FP 5’ TTGAGGCAGACCAGATTGACG 3’RP 5’ TATGACAGCGACTCCGATTCC 3’
cfr746FP 5’ TGAAGTATAAAGCAGCTTGGGAG 3’RP 5’ ACCATATAATTGACCACAAGCAG 3’

FP – Forward Primer, RP – Reverse Primer, bp- Base Pairs


The primers were sourced from Eurofins Genomics, Bangalore. The quality control strains used were Staphylococcus aureus ATCC® 25923, E. faecalis ATCC® 29212, E. faecalis ATCC® 51299, E. faecium ATCC® 700221, E. faecium ATCC® 19434. Mili-Q water was used as negative control. (GenBank Accession number of VanA, VanB, VanC1-E. faecalis and E. faecium genes are CP019995.1, U00456.1, EU151771.1, CP003726.1 and CP003583.1 respectively).

Multiplex PCR (Eppendorf, USA) was carried out to detect the presence of genes encoding for vancomycin resistance. Of the many genotypes of vancomycin resistance described in enterococci, attempt was made to identify the most common ones, i.e., VanA, VanB and VanC genotypes [Table/Fig-3a,b]. The linezolid resistant E. faecium was tested for presence of cfr gene by PCR [Table/Fig-4].

a) Agarose gel electrophoresis of the amplified products by PCR for vanA(732 bp) and VanB(536 bp) genes. Ladder 100bp DNA ladder, A and B - positive control for vanA (E. faecium ATCC®700221TM) and VanB (E. faecalis ATCC® 51299TM), NC- Mili-Q water was used as negative control; b) Agarose gel electrophoresis of the amplified products by PCR for vanA(732 bp). Ladder 100bpDNA ladder,S1- clinical sample positive for vanA and S2 – faecal sample from same patient positive for vanA, PC-E. faecium ATCC®700221TM was used as positive control for vanA; NC- Mili-Q water was used as negative control.

Agarose gel electrophoresis of the amplified products by PCR for cfr gene(746 bp).

Ladder- 100bp DNA ladder, S- sample, PC- Staphylococcus aureusATCC® 25923TM was used as positive control, NC- Mili-Q water was used as negative control

After completion of PCR reaction, 10 μL of each PCR product were mixed with 2 μL of bromophenol blue dye. This mixture was loaded in well of 1.5% agarose gel and electrophoresed at constant 80 volts with Tris -Acetate Ethylene Diamine Tetra Acetic acid (TAE) buffer. Molecular marker of 100 bp DNA ladder was run concurrently in a separate well. The gel stained with 0.5 mg/mL of ethidium bromide was visualised using a UV transilluminator (Alpha Innotech, Cell Biosciences, USA).

Clinical history of patients infected with VRE isolates was obtained and were screened for gut colonization with VRE. Fecal samples were inoculated onto vancomycin screen agar with 6 μg/mL of vancomycin, incubated overnight at 37°C. VRE isolates were further processed for species identification and genotypic characterization.

Statistical Analysis

SPSS software version 21.0 was used. Continuous data was analysed using the Student’s t-test. Categorical data was assessed using Pearson’s Chi-square test. A value of p ≤ 0.05 was considered statistically significant.

Results

Out of 4200 samples processed, a total of 250 (5.9%) enterococci were isolated. The isolates were from urine (128; 51.2%), blood (75; 30.0%), and pus (47; 18.8%). The distribution of enterococci isolates in hospitalized patients is described in [Table/Fig-5]. The isolates were from 182 (72.8%) adults and 68 (27.2%) paediatric patients. Male to female ratio in adult age group was 1:1.2 and in paediatric age group it was 1:1.

Distribution of enterococci and VRE isolates among different clinical departments. Figures in parenthesis are percentages.

LocationEnterococci isolatesN=250(%)VRE isolatesN=63(%)
Paediatric ward66 (26.4)17 (27.0)
ICU[Adult (47), Paediatric (2)]49 (19.6)27 (42.8)
Obstrtrics and Gynaecology45 (18.0)7 (11.1)
Medicine36 (14.4)2 (3.2)
Nephrology23 (9.2)7 (11.1)
Orthopaedics15 (6.0)1 (1.6)
Surgery11 (4.4)1 (1.6)
Burns ICU5 (2.0)1 (1.6)

Species Distribution among the Enterococci Isolates

E. faecium (162, 64.8%) was the most common species followed by E. faecalis (82, 32.84%). Motile enterococci (6, 2.4%), were confirmed as E. gallinarum by Vitek 2 system (bioMeriux, USA).

Antimicrobial Resistance among Enterococci Isolates

Among 250 enterococci isolates, 174 (69.6%) were resistant to ampicillin, 187 (74.8%) to high level gentamycin, 240 (96.0%) to ciprofloxacin, 57 (22.8%) to vancomycin and 56 (22.4%) to teicoplanin by disk diffusion method. Among urinary isolates, 42 (32.8%) and 118 (92.2%) isolates showed in vitro resistance to nitrofurantoin and norfloxacin respectively. One isolate was also resistant to linezolid. Although all isolates were susceptible to tigecycline by disk diffusion method, discordant results were observed in two isolates, which were resistant with MIC near breakpoints (MIC= 1.5 and 2μg/mL). E. faecium was more resistant species as compared to E. faecalis [Table/Fig-6].

Antibiotic resistance pattern of enterococci isolates by disc diffusion method. Figures in parenthesis are percentages.

No. of Isolates (%)% Resistance
Gentamycin(120 μg)Ciprofloxacin(5 μg)Ampicillin(10 μg)Vancomycin(30 μg)Teicoplanin(30 μg)Nitrofurantoin^(300 μg)Norfloxacin^(10 μg)
E. faeciumN=162 (64.8)135 (83.3)162 (100)156 (96.3)55 (33.9)54 (33.3)36/84 (42.8)84/84 (100)
E. faecalisN=82(32.8)52 (63.4)74 (90.2)18 (21.9)2 (2.4)2 (2.4)6/43(13.9)34/43 (79.1)
*E. gallinarumN=6 (2.4)04 (66.7)00*000
TotalN=250187 (74.8)240 (96.0)174 (69.6)57 (22.8)56 (22.4)42/128 (32.8)118/128 (92.2)

*E. gallinarum strains are intrinsically resistant to vancomycin, but they may appear sensitive by disc diffusion method.

^ Tested only in urinary isolates.


There was a good correlation between vancomycin agar dilution and E test. Vancomycin MIC ranged 0.25-1 μg/mL in majority of isolates (187, 74.8%). Six (2.4%) isolates MIC range was 2-3 μg/mL and were identified as E. gallinarum. High level vancomycin resistance was observed in rest 57 (22.8%) isolates (MIC= 64 ->256 μg/mL). Among isolates with high level vancomycin resistance (n= 57), 56 isolates were resistant to teicoplanin (MIC = 32 - >256 μg/mL) suggestive of VanA phenotype. One isolate was sensitive to teicoplanin (MIC = 8μg/mL) suggestive of VanB phenotype. The six E. gallinarum isolates were sensitive to teicoplanin (MIC from 0.5-1 μg/mL).

Majority (57/63, 90.5%) of VRE isolate carried VanA gene. Species distribution among the VanA gene carriers was E. faecium (55, 87.3%) followed by E. faecalis (2, 3.2%). Rest (6, 9.5%) VRE isolates were of E. gallinarum species carried VanC1 gene. VanB genotype was absent in the present study. The phenotypic VanB isolate was identified as VanA genotypically.

Gut colonization could be studied only in 47/63 patients with VRE infections. Majority 33/47 (70.2%) were colonized with VRE. The respective fecal isolates of enterococci were phenotypically (species, antibiogram) and genotypically (resistance gene) similar to the clinical isolates [Table/Fig-3b]. Risk factors for VRE gut colonization were evaluated and only the sex of the patients was significantly associated (p=0.045) [Table/Fig-7].

Demographic data and risk factors associated with VRE gut colonization. Student’s t-test and Pearson’s Chi-square test were used for analysing continuous and categorical data respectively.

VariableClassGut colonizationp-value*
Positive (33)Negative (14)
SexMale20 (60.6%)4 (28.6%)0.045
Female13 (39.4%)10 (71.4%)
Age groupAdult27 (81.8%)11 (78.6%)0.796
Paediatric6 (18.2%)3 (21.4%)
Metronidazole inj.Yes12 (36.4%)7 (50.0%)0.384
No21 (63.6%)7 (50.0%)
VancomycinYes8 (24.2%)3 (21.4%)0.835
No25 (75.8%)11 (78.6%)
Intravenous catheterYes32 (97.0%)13 (92.8%)0.512
No1 (3.0%)1 (7.2%)
DialysisYes11 (33.3%)3 (21.4%)0.503
No22 (66.7%)11 (78.6%)
Nasogastric tubeYes21 (63.6%)9 (64.3%)0.966
No12 (36.4%)5 (35.7%)
TracheostomyYes3 (9.1%)2 (14.3%)0.627
No30 (90.9%)12 (85.7%)
Ventilator useYes17 (51.5%)6 (42.8%)0.587
No16 (48.5%)8 (57.2%)
Length of hospitalization (days)Mean (Range)15.73 (5-130)12.71 (5-20)0.6

*p value ≤ 0.05 is significant.


The genetic characteristics of VRE and MIC50, MIC90, MIC range of vancomycin, teicoplanin, daptomycin, linezolid, tigecycline and quinupristin-dalfopristin are shown in [Table/Fig-8]. All the VRE isolates were susceptible to daptomycin (MIC = 0.094–4 μg/mL), quinupristin-dalfopristin (MIC = 0.023-1 μg/mL). Two (3.2%) isolates were resistant to tigecycline (MIC = 1.5 and 2 μg/mL). One (1.6%) of the VRE isolate was resistant to linezolid (MIC = 12 μg/mL). cfr gene was detected in a linezolid resistant isolate by PCR.

Phenotypic and genotypic characterization of VRE isolates with MICs for various antibiotics. No VanB genotype detected.

PhenotypeGenotypeSpeciesMIC of higher antibiotics (μg/mL)
VancomycinTeicoplaninDaptomycinLinezolidTigecyclineQuinupristin-Dalfopristin
MIC50MIC90RangeMIC50MIC90RangeMIC50MIC90RangeMIC50MIC90RangeMIC50MIC90RangeMIC50MIC90Range
VanA(n=56)VanB(n=1)vanA(n=57)E.faecium(n=55)E.faecalis(n=2)>256>25664-51224648-512240.094-40.7520.047-120.0640.250.023- 20.064.250.023-1
VanC(n=6)vanC1(n=6)E.gallinarum(n=6)232-30.2510.125-10.12520.064-20.0640.1250.047-0.1250.0640.1250.023-0.1250.0470.250.023-0.25

Discussion

Vancomycin resistant enterococci have been reported from many countries of the world since 1986 [2]. Widespread use of vancomycin and extended-spectrum cephalosporins in hospitals contributed to the worldwide emergence of VRE and has made it difficult to treat serious enterococcal infections over the past 20 years [12].

The prevalence of VRE infections in India is also increasing in the past one decade. Mathur P et al., from New Delhi was the first to report VRE from India in 1999 [13]. The reports of prevalence of VRE from India vary from 1% to 8.7%. In the present study, a total of 63 (25.2%) VRE isolates were obtained and rate is high as compared to other Indian studies [3,14-17]. Out of 63 VRE strains, 32 (50.8%) were from urine, 25 (39.7%) from blood, and 6 (9.5 %) from pus samples. In this study, majority of VRE isolates were from ICU [Table/Fig-5], and the finding is similar to another study from Northern India [3].

Glycopeptide resistance as per literature is mediated by six different Van gene operons namely VanA, VanB, VanC, VanD, VanE and VanG. Recently new gene clusters have been discovered (VanL, VanM, and VanN). In the present study, most (57, 90.5%) of the VRE isolates carried VanA gene suggesting high level resistance to glycopeptides. Rest (6, 9.5%) were positive for VanC1 gene suggesting intrinsic low level resistance to vancomycin. One isolate was VanB phenotype-VanA genotype and in concurrence with another Indian study [17].

Among the various antimicrobials evaluated for treatment of serious infections with VRE are quinupristin-dalfopristin, linezolid, daptomycin and tigecycline. In the present study, one VRE isolate was resistant to linezolid (MIC=12 μg/mL) and two isolates were resistant to tigecycline (MIC = 1.5 and 2 μg/mL). On genotypic analysis, cfr gene was detected in the linezolid resistant strain. Linezolid resistant enterococci have been recently reported from India [18]. In another study cfr gene has been detected in linezolid resistant staphylococci [19]. Yasliani S et al., reported two isolates of E. faecium resistant to linezolid from Tehran with MIC 32 μg/mL [20]. Linezolid resistance has increased substantially after inclusion of linezolid on the hospital antibiotic policy [21]. Tigecycline resistance in VRE isolates has been reported from Taiwan and Turkey [22,23]. In India, tigecycline resistance in VRE isolates has not been reported so far.

There are several studies for the surveillance of colonization of Enterococcus spp. in the gastrointestinal tract, a major site of initial colonization. In a surveillance study from two ICUs in Brazil, VRE strains were isolated from 32.6% patients in rectal swabs and in 20% VRE isolated in their clinical samples also [24]. In a study from ICU and post-surgery ward in a hospital in Iran, 29.3% patients had rectal colonization for VRE [25]. In the present study, among patients with infection due to VRE, gut colonization was observed in 33/47 (70.2%). Detection of phenotypically and genotypically (VanA) similar isolates from clinical sample and gut is indicative of endogenous infection. Gut colonization with VRE may be a source of endogenous infection or horizontal transfer among hospitalized patients due to breach in infection control practices. Based on the high colonization status, review of the ongoing antibiotic policy and active VRE surveillance as an integral part of infection control strategy were suggested [25]. To the best of our knowledge, detection of cfr gene in linezolid resistant E. faecium and tigecycline resistance in VRE isolate along with characterization of VRE and their association with gut is reported for the first time from India.

Limitation

Gut colonization hypothesis could not be confirmed by molecular studies like Pulse Field Gel Electrophoresis (PFGE).

Conclusion

Vancomycin resistance among enterococci is an emerging threat. Emergence of tigecycline and linezolid resistance mediated by cfr gene further narrows therapeutic options. Gut colonization with VRE may be a source of endogenous infection and horizontal transmission within the hospital. The threat of untreatable enterococcal infection and the possibility that vancomycin resistance may spread from enterococci to other common Gram-positive bacteria namely staphylococci argue for strict surveillance.

Financial or Other Competing Interests

None.

References

[1]Bonten MJ, Willems R, Weinstein RA, Vancomycin resistant enterococci: Why are they here and where do they come from? Lancet Infect Dis 2001 1:314-25.  [Google Scholar]

[2]Sood S, Malhotra M, Das BK, Kapil A, Enterococcal infections & antimicrobial resistanceIndian J Med Res 2008 128:111-21.  [Google Scholar]

[3]Mathur P, Kapil A, Chandra R, Sharma P, Das B, Antimicrobial resistance in Enterococcus faecalis at a tertiary care centre of northern IndiaIndian J Med Res 2003 118:25-28.  [Google Scholar]

[4]NNISNational Nosocomial Infections Surveillance (NNIS) System Report, data summary from January 1992 through June 2004, issued October 2004Am J Infect Control 2004 32:470-85.  [Google Scholar]

[5]Courvalin P, Vancomycin resistance in Gram positive cocciClin Infect Dis 2006 42:25-34.  [Google Scholar]

[6]Sujatha S, Praharaj I, Glycopeptide resistance in Gram positive cocci: A reviewInterdiscip Perspect Infect Dis 2012   [Google Scholar]

[7]Collee JG, Fraser AG, Marmion BP, Simmons A, Mackie & McCartney Practical Medical Microbiology 1996 14th edEdinburgChurchill Livingstone:53-93.  [Google Scholar]

[8]Facklam RR, Collins MD, Identification of Enterococcus species isolated from human infections by a conventional test schemeJ Clin Microbiol 1989 27:731-34.  [Google Scholar]

[9]CLSIPerformance Standard for Antimicrobial Susceptibility Testing. Twenty second Informational Supplement. CLSI document M100-S22 2012 Wayne, PAClinical and laboratory standard institute  [Google Scholar]

[10]European Committee on Antimicrobial Susceptibility Testing (2013) Breakpoint tables for interpretation of MICs and zone diameters. Available from: URL: http://www.eucast.org  [Google Scholar]

[11]Sambrook J, Fristch EF, Maniatis T, Molecular cloning: A Laboratory Manual 1989 2nd edCold Spring Harbour Laboratory Press:E3-E4.  [Google Scholar]

[12]Salem-Bekhit MM, Moussa IM, Muharram MM, Alanazy FK, Hefni HM, Prevalence and antimicrobial resistance pattern of multidrug-resistant enterococci isolated from clinical specimensIndian J Med Microbiol 2012 30:44-51.  [Google Scholar]

[13]Mathur P, Chaudhary R, Dhawan B, Sharma N, Kumar L, Vancomycin-resistant Enterococcus bacteraemia in a lymphoma patientIndian J Med Microbiol 1999 17:194-95.  [Google Scholar]

[14]Taneja N, Rani P, Emmanuel R, Sharma M, Significance of vancomycin resistant enterococci from urinary specimens at a tertiary care centre in northern IndiaIndian J Med Res 2004 119:72-74.  [Google Scholar]

[15]Kapoor L, Randhawa VS, Deb M, Antimicrobial resistance of enterococcal blood isolates at a paediatric care hospital in IndiaJpn J Infect Dis 2005 58:101-03.  [Google Scholar]

[16]Kaur N, Chaudhary U, Aggarwal R, Bala K, Emergence of VRE and their antimicrobial sensitivity pattern in a tertiary care teaching hospitalJ Med BiolSci 2009 8:26-32.  [Google Scholar]

[17]Praharaj I, Sujatha S, Parija SC, Phenotypic & genotypic characterization of vancomycin resistant Enterococcus isolates from clinical specimensIndian J Med Res 2013 138:549-56.  [Google Scholar]

[18]Rai S, Niranjan DK, Kaur T, Singh NP, Hada V, Kaur IR, Detection of the classical G2576U mutation in linezolid resistant Staphylococcus aureus along with isolation of linezolid resistant Enterococcus faecium from a patient on short-term linezolid therapy: First report from IndiaIndian J Med Microbiol 2015 33:21-24.  [Google Scholar]

[19]Rajan V, Kumar VGS, Gopal S, A cfr-positive clinical staphylococcal isolate from India with multiple mechanisms of linezolid-resistanceIndian J Med Res 2014 :463-67.  [Google Scholar]

[20]Yasliani S, Mohabati Mobarez A, Hosseini Doust R, Satari M, Teymornejad O, Linezolid vancomycin resistant Enterococcus isolated from clinical samples in Tehran hospitalsIndian J Med Sci 2009 63:297-302.  [Google Scholar]

[21]Raad II, Hanna HA, Hachem RY, Dvorak T, Arbuckle RB, Chaiban G, Clinical-use-associated decrease in susceptibility of vancomycin-resistant Enterococcus faecium to linezolid: a comparison with quinupristin-dalfopristinAntimicrob Agents Chemother 2004 48:3583-85.  [Google Scholar]

[22]Tsai HY, Liao CH, Chen YH, Lu PL, Huang CH, Lu CT, Trends in Susceptibility of Vancomycin-Resistant Enterococcus faecium to Tigecycline, Daptomycin, and Linezolid and Molecular Epidemiology of the Isolates: Results from the TigecyclineIn Vitro Surveillance in Taiwan (TIST) Study, 2006 to 2010Antimicrob Agents Chemother 2012 56:3402-5.  [Google Scholar]

[23]Altun S, Altun HU, Hatipoğlu CA, Bulut C, Kinikli S, Demiröz AP, Daptomycin and tigecycline susceptibility of vancomycin resistant enterococci isolated from rectal swab culturesJ Microbiol Infect Dis 2014 4:107-10.  [Google Scholar]

[24]Furtado GHC, Martins ST, Coutinho AP, Wey SB, Medeiros E, Prevalence and Factors Associated With Rectal Vancomycin-Resistant Enterococci Colonization in Two Intensive Care Units in São Paulo, BrazilBraz J Infect Dis 2005 9:64-69.  [Google Scholar]

[25]Javadi A, Ataei B, Khorvash F, Toghyani S, Mobasherzadeh S, Soghrati M, Prevalence of vancomycin resistant Enterococci colonization in gastrointestinal tract of hospitalized patientsIran J Clin Infect Dis 2008 3:137-141.  [Google Scholar]