JCDR - Register at Journal of Clinical and Diagnostic Research
Journal of Clinical and Diagnostic Research, ISSN - 0973 - 709X
Microbiology Section DOI : 10.7860/JCDR/2017/25518.10258
Year : 2017 | Month : Jul | Volume : 11 | Issue : 7 Full Version Page : DC27 - DC31

Distribution of SCCmec Elements and Presence of Panton-Valentine Leukocidin in Methicillin-Resistant Staphylococcusepidermidis Isolated from Clinical Samples in a University Hospital of Isfahan City, Iran

Mehrdad Halaji1, Ashkan Karimi2, Parisa Shoaei3, Mohammadreza Nahaei4, Farzin Khorvash5, Behrooz Ataei6, Majid Yaran7, Seyed Asghar Havaei8

1 Department of Microbiology, School of Medicine, Isfahan University of Medical Sciences, Isfahan, Iran.
2 Department of Microbiology, Ahar Branch, Islamic Azad University, Ahar, Iran.
3 Nosocomial Infection Research Center, Isfahan University of Medical Sciences, Isfahan, Iran.
4 Department of Microbiology, Ahar Branch, Islamic Azad University, Ahar, Iran.
5 Nosocomial Infection Research Center, Isfahan University of Medical Sciences, Isfahan, Iran.
6 Acquired Immunodeficiency Research Center, Isfahan University of Medical Sciences, Isfahan, Iran.
7 Infectious Diseases and Tropical Medicine Research Center, Isfahan University of Medical Sciences, Isfahan, Iran.
8 Nosocomial Infection Research Center, Isfahan University of Medical Sciences, Isfahan, Iran.


NAME, ADDRESS, E-MAIL ID OF THE CORRESPONDING AUTHOR: Dr. Seyed Asghar Havaei, Nosocomial Infection Research Center, Isfahan University of Medical Sciences, Isfahan, Iran.
E-mail: havaei@med.mui.ac.ir
Abstract

Introduction

Coagulase Negative Staphylococcus (CoNS) is considered as a major pathogen of nosocomial infections among immunosuppressed patients.

Aim

The aim of this study was to identify the types of Staphylococcal Cassette Chromosome mec (SCCmec) and Panton-Valentine Leukocidin (PVL) gene among clinical Methicillin-Resistant S. epidermidis (MRSE) isolates collected from Isfahan.

Materials and Methods

This cross-sectional study was performed from March 2014 to January 2015 at a tertiary care hospital of Isfahan, Iran. Antimicrobial susceptibility tests of S. epidermidis isolates were performed by the disc diffusion method. All the strains were screened for methicillin resistance based on resistance to cefoxitin (30 μg) disc and presence of mecA gene. Determination of SCCmec typing and PVL toxin gene were performed by PCR method. For categorical variables different groups were compared using the Chi-square test or Fisher exact test. A p-value of <0.05 was considered significant for all statistical tests.

Results

The frequency of MRSE was 53.8% according to the presence of mecA gene. The overall resistance rate was high with ciprofloxacin (81.4%). PCR analysis showed that 17% (12/70) of MRSE isolate carried the PVL gene and 43% (30/70) were SCCmec type I; 11.4% (8/70) were type II; and 34.2% (24/70) were type IV, whereas, 11.4% (8/70) of the MRSE isolates could not be typed.

Conclusion

SCCmec type I was the major type of SCCmec, which indicates an emergence of this SCCmec type in the studied medical centers. Increased prevalence of SCCmec types in community is cause of an increase in antibiotic resistance among microorganisms.

Keywords

Antibiotic resistance, Cefoxitin, Chromosome, Cytotoxins

Introduction

Coagulase-Negative Staphylococcus (CoNS) is considered as an important agent of nosocomial or healthcare-associated infections among immunosuppressed patients and elderly individuals [1,2]. In the past decades, CoNS was considered as a commensal bacterium and normal bacterial flora of healthy human skin, but currently, these organisms are considered as common cause of human diseases [3]. CoNS has also been found the third most common causative agent of nosocomial infections. Among CoNS, Staphylococcus epidermidis is an important pathogen in neonatal sepsis and patients who use medical equipments such as urinary catheters and other implanted devices [4]. Approximately 75%-90% of these bacteria, circulating in hospitals are resistance to Methicillin [5-7]. The resistance of S. epidermidis to methicillin is encoded by the expression of Penicillin Binding Protein (PBP2a) with a low affinity for this antibiotic. PBP2a is encoded by the mecA gene, which is located on a mobile genetic element and it is called the SCCmec [8].

SCCmec is widely disseminated among Staphylococcus aureus and CoNS species. Generally, SCCmec types are defined based on mec gene complex and ccr (Cassette Chromosome Recombinases) gene complex [9,10]. In addition, SCCmec are divided into subtype according to difference in the j region DNA. According to previous reports, in S. aureus 11 types of SCCmec and several subtypes have been observed [11,12]. In comparison with S. aureus, molecular characterization of this element revealed five SCCmec types in S. epidermidis [2,13]. Due to the presence of new variants of ccr genes, SCCmec structures are more diverse in S. epidermidis. Therefore, these results indicate a high percentage of genetic diversity within the SCCmec elements carried by S. epidermidis [14,15]. So far, several molecular typing techniques including Pulsed Field Gel Electrophoresis (PFGE), Multilocus Sequence Typing (MLST) and SCCmec typing have been used for investigating the spread of MRSE. These molecular typing techniques enable enhancing clinical therapy and infection control in the future by presenting useful data. SCCmec types have been used to distinguish Hospital-Associated Methicillin-Resistant Staphylococcus (HA-MRS) from Community-Associated Methicillin Resistant Staphylococcus (CA-MRS) [16]. Some S. epidermidis strains produce PVL cytotoxin and biofilm as key virulence factors which increase the pathogenecity of these microorganisms. PVL is a cytotoxin that causes damage to the membranes of host defense cells and is associated with tissue necrosis as well [17-19]. Since, there is no adequate data about the prevalence of SCCmec diversity and PVL gene among clinical isolates of S. epidermidis in our region, the present study aimed to identify the types of SCCmec and PVL gene among clinical MRSE isolates collected from Isfahan.

Materials and Methods

Study Design and Population

This cross-sectional study was carried out from March 2014 to January 2015 in Al-Zahra hospital, affiliated to Isfahan University of Medical Sciences, Isfahan, Iran. All the parts of study were supervised and approved by the Ethical Committee of Isfahan University of Medical Sciences (code 293253).

Bacterial Isolation and Identification

One hundred and thirty S. epidermidis isolates were collected from clinical samples of patients who referred to Isfahan’s AL-Zahra hospital (Iran). The isolates were recovered from wounds (n=30), blood (n=18), urine (n=60), sputum (n=7), Bronchoalveolar Lavage (BAL) (n=5), and abscesses (n=10). Thereafter, all isolates were identified as S. epidermidis using different conventional methods including Gram staining, catalase test, plasma coagulase test, and final identification of S. epidermidis was performed by the ability of urease production and carbohydrate fermentation [10]. All strains were stored at -70°C in Trypticase Soy Broth (TSB), with 20% glycerol.

Antimicrobial Susceptibility Assay

Antimicrobial susceptibility tests of S. epidermidis isolates were performed by the disc diffusion method on Mueller– Hinton agar (Himedia, India) according to the guidelines of Clinical and Laboratory Standards Institute (CLSI) for gentamycin (10 μg), oxacillin (1 μg), tetracycline (30 μg), ciprofloxacin (5 μg), clindamycin (2 μg), Co-Trimoxazole (SXT- 1.25/23.75 μg), rifampin (5 μg), and vancomycin antibiotic discs (MAST, UK) [20]. S. aureus ATCC® 25923™, which is a methicillin-sensitive S. aureus, was used as the control strain in antibacterial susceptibility testing. All the strains were screened for methicillin resistance based on resistance to cefoxitin (30 μg) discs (MAST, UK) by the disc diffusion method according to the CLSI 2013 guidelines.

DNA Extraction and PCR Assay

Bacterial genomic DNA of suspected isolates were extracted directly from 24 hours colonies by boiling a dense suspension in sterile distilled water for 10 minutes and centrifuged for two minutes at 13,000×g [21]. The genomic DNA was used as a template for typing of SCCmec, detection of mecA and the PVL cytotoxin gene. The PCR for amplification of mecA gene was performed as described previously [22].

Detection of the PVL Gene

PCR was performed to determine the presence of the PVL cytotoxin gene as previously described by Azimian A et al., [22].

SCCmec Typing by Multiplex-PCR

The SCCmec type was determined in a multiplex PCR which included four pairs of primers for the SCCmec types I- IV. PCR was performed in a mixture of 30 μl volume containing 15 μl master mix, 0.5 μl of each of α3R1, βF1, ccrCF and ccrCR primers (10 pmol/μl), 0.3 μl of each of 1272F1, 1272R1, 5RmecAF, 5R431R primers (10 pmol/μl) and 2 μl template DNA. The final volume was adjusted to 30 μl by adding 9.8 μl sterile ultrapure water and was placed on thermal cycler [23]. Amplification protocol consisted of five minutes initial denaturation at 93°C, followed by 30 cycles of denaturation (93°C/45 seconds), annealing (55°C/30 seconds), and extension (72°C/90 seconds), and an additional post-amplification extension step at 72°C for five minutes. The primers used for the PCR are listed in [Table/Fig-1]. The following S. aureus reference strains were used as controls: COL; N315; 85/2082; and JCSC/4469 for the SCCmec types I, II, III, and IV, respectively [Table/Fig-2].

List of primers used in this study.

TargetPrimerSequenceProduct size (bp)Reference
SCCmecβ F1ATTGCCTTGATAATAGCCYTCT937[23]
α3 R1TAAAGGCATCAATGCACAAACACT
ccrC FCGTCTATTACAAGATGTTAAGGATAAT518[23]
ccrC RCCTTTATAGACTGGATTATTCAAAATAT
1272 FGCCACTCATAACATATGGAA415[23]
1272 RCATCCGAGTGAAACCCAAA
5RmecAFTATACCAAACCCGACAACTAC359[23]
5R431RCGGCTACAGTGATAACATCC
PVLPVL FGGAAACATTTATTCTGGCTATAC502[22]
PVL RCTGGATTGAAGTTACCTCTGG
mecAFAGAAGATGGTATGTGGAAGTTAG583[23]
RATGTATGTGCGATTGTATTGC

*F: Forward, R: Reverse


C-: negative control (distilled water); lane 1: SCCmec type I (COL); lane 2: SCCmec type II (N315); lane 3: SCCmec type 3 (85/2082); lane 4: SCCmec type IV (JCSC/4469); M: 100 bp ladder.

Statistical Analysis

Data were entered and analysed by Statistical Package for the Social Sciences (SPSS) software version 20.0. The description of the results was carried out by frequencies. For categorical variables different groups were compared using the Chi-square test or Fisher-exact test. All probabilities were two-tailed and a p-values < 0.05 was considered to be statistically significant.

Results

Frequency of MRSE

Out of total 130 S. epidermidis isolates, the frequency of MRSE was 52.3% (n=68) and 53.8% (n=70) according to the disc diffusion and presence of mecA gene, respectively. Phenotypic (Cefoxitin disc) and molecular (mecA detection) based MRSE screening methods showed different results [Table/Fig-3]. Specimen wise distribution showed that MRSE was most frequent in urine (53%), followed by blood (11.4%), sputum (5.7%), wound (25.6%) and BAL (4.3%). On the other hand, the frequency of MRSE was found to be 42.7% and 57.3% for female and male respectively.

PCR amplification of the mecA genes. Lane 1: Negative Control, Lane 2: 100 bp-3k b ladder, lane 3: positive control for mecA genes (583bp), lane 4-7: positive results for mecA genes.

Antibiotic Susceptibility Pattern of S. epidermidis Isolates

The antibiotic susceptibility showed that all MRSE isolates were 100% sensitive to vancomycin. The overall resistance rates were high with ciprofloxacin (81.4%) and co-trimoxazole (64%), while the lowest level of antibiotics resistance were against gentamycin (37.1%). [Table/Fig-4] shows the distribution of antibiotic resistance among MRSE isolates based on SCCmec type.

Distribution of antibiotic resistance among MRSE isolates by SCCmec types.

AntibioticSCCmec I (n=30)SCCmec II (n=8)SCCmec IV (n=24)Untypeable (n=8)Total (n=70)
Gentamycin11112226
Oxacillin24524659
Tetracycline23315344
Ciprofloxacin26619657
Clindamycin15415438
Co-trimoxazole19515645
Rifampin14315032
Vancomycin00000

Characterization of SCCmec Type and PVL Gene

Results from PCR analysis shown that 12 (17%) of MRSE isolates carried the PVL gene [Table/Fig-5]. In addition, of the 70 MRSE isolates, 43% (30/70) were SCCmec type I; 11.4% (8/70) were type II; 34.2% (24/70) were type IV and 11.4 (8/70) of the MRSE isolates could not be typed, whereas, none of the isolates were identified as SCCmec type III [Table/Fig-6]. The SCCmec type I of MRSE isolates were significantly (p<0.05) recovered as the major type from 19 (63.3%) urine followed by 5 (16.7%) from wound, 3 (10%) from blood and 3 (10%) from sputum, while the SCCmec type II isolates were 4 (50%) from sputum, 3 (37.5%) from urine, 1 (12.5%) from wound and the SCCmec type IV isolates were mostly 13 (54.1%) isolated from the urine samples, 8 (33.4%) from blood and 3 (12.5%) from sputum. Also, the majority of PVL-positive isolates were SCCmec type I (50%).

PCR amplification of the PVL genes. Lane 1: Negative Control, Lane 2 100 bp-3kb ladder, lane 3: Positive control for PVL genes (502bp), Lane 4-7: Positive results for PVL genes.

Positive results for SCCmec types I (415bp), II (937bp), IV (937/415 bp).

Discussion

S. epidermidis, especially MRSE, is one of the major causes of serious infections such as catheter-related blood stream infections [24]. Its various virulence factors and high rate of methicillin resistance among S. epidermidis, cause various problems for patients and healthcare providers during treatment [1]. To investigate outbreaks in nosocomial infections, determination of the source is very important that molecular typing is a valuable tool for this purpose [25].

The purpose of this study was to investigate SCCmec types, PVL gene and determining antimicrobial resistance patterns of clinical MRSE isolates collected from patient in Isfahan. Antibiotic resistance of MRSE to ciprofloxacin, cefoxitin, clindamycin, tetracycline, gentamycin, cotrimoxazole, rifampin and vancomycin using disk diffusion method was investigated. Our results showed that the prevalence of methicillin resistance among the S. epidermidis isolates was found to be 70 (53.8%) which is in contrast with Namvar AE et al., with 83.4% [23]. This resistance rate was lower than those found in the rest of Iran [23,26]. In a similar study carried out by Du X et al., prevalence of MRSE isolates was 86.7% among clinical isolates which are in contrast with the current study [27]. However, the prevalence of MRSE varied widely among different population and regions representing different health policies and other factors involved.

S. epidermidis isolates were resistant to many common antibiotics in the clinic. In antimicrobial susceptibility pattern of isolates, ciprofloxacin (81.4%) and co-trimoxazole (64%) had the highest resistance, while resistance to rifampin and gentamycin was 45.7% and 37.1% respectively. Also, all the isolates were completely sensitive to vancomycin. Overall, the rate of antibiotic resistance in our results was lower than the previous studies which can be associated with the pattern of antibiotic use in medical wards [15,26]. In the present study, SCCmec typing was used for detection and epidemiological investigations of isolates. Our findings show that a total of 70 MRSE isolates, SCCmec type were found in 88.5% (62/70) isolates. In other words, among MRSE isolates, the most common SCCmec type was type I, with a frequency rate of 43% (30/70), the second most frequent SCCmec was type IV with a rate of 34.2% (24/70) followed by type II in 11.4% (8/70) of isolates, whereas 11.4% (8/70) of the MRSE isolates could not be typed. Consistent with our results, Mertens A et al., revealed that 39.5% of S. epidermidis isolates carry SCCmec type I [28]. Also, in a study in Brazil, Machado ABMP et al., in 2013 indicated that 27.9% of S. epidermidis isolates harboured SCCmec type I, these data was similar to our results. In addition, Machado ABMP et al., showed no SCCmec type II in their population which is different with our finding [13]. In a study by Namvar AE et al., characterization of SCCmec in S. epidermidis identified 2 (2.1%) isolates harboured SCCmec type I, and the rate of SCCmec type IV were 42 (43.8%) which is in contrast to the results found in our study [23]. Possible reasons for the wide range of SCCmec type might be due to differences in geographical regions, the study population, and detection methods [29,30]. Our result is similar to studies which have shown that non-typeable SCCmec among S. epidermidis isolate’s rate is higher than others [2,23]. This higher rate might be due to the presence of other SCCmec types [31,32]. Most of the SCCmec type I and IV isolates were resistant to all antibiotics excluding vancomycin, while in comparison to other types, SCCmec type II isolates were found to be more sensitive to gentamycin, tetracycline and rifampin. Generally, among all of SCCmec types, the highest antibiotic sensitivity of the isolates was against gentamycin, followed by rifampin. Our results showed, 17% (12/70) carried the PVL gene and these data indicated a high rate of PVL gene among S epidermidis. In comparison with the present study, Sani NAM et al., revealed 8% of the S. epidermidis isolate had the complete operon of staphylococcal toxin genes such as PVL [33]. Also, in a study in Korea, PCR results for PVL revealed 15 (71.4%) of the S. epidermidis isolates carried the PVL genes [34]. Although, several reports demonstrate low prevalence of PVL gene similar to our findings which is usually associated with cutaneous infections. While, PVL gene for CoNS was absent in a number of studies [35,36]. Increased prevalence of PVL gene and SCCmec types among S. epidermidis isolates is an alarming situation. Further investigations are needed to be done on the same to prevent any complications regarding the treatment in near future.

Limitation

There were several limitation to our study; first, detection of other types of SCCmec and their subtypes was not performed. Second, the patients participated in the study were from one hospital causing difficulty to generalize our results to other hospitals. Last, our sample size was not enough to interpret the characterization of SCCmec and distribution of MRSE in our region. MIC of vancomycin and other antimicrobial agents was not determined.

Conclusion

Screening and isolation of MRSE-positive patients is essential in order to control the transmission of MRSE in both community and hospitals. SCCmec typing is useful in differentiating both and thus can be used for early diagnosis of infections.

Financial or Other Competing Interests

None.

References

[1]Otto M, Staphylococcus epidermidis —the ‘accidental’ pathogenNature Rev Microbiol 2009 7(8):555-67.  [Google Scholar]

[2]Svensson K, Hellmark B, Söderquist B, Characterization of SCCmec elements in methicillin-resistant Staphylococcus epidermidis isolated from blood cultures from neonates during three decadesApmis 2011 119(12):885-93.  [Google Scholar]

[3]Cantey JB, Milstone AM, Bloodstream infections: epidemiology and resistanceClin Perinatol 2015 42(1):1-16.  [Google Scholar]

[4]Piette A, Verschraegen G, Role of coagulase-negative staphylococci in human diseaseVet Microbiol 2009 134:45-54.  [Google Scholar]

[5]Diekema DJ, Pfaller MA, Schmitz FJ, Smayevsky J, Bell J, Jones RN, Survey of infections due to Staphylococcus species: Frequency of occurrence and antimicrobial susceptibility of isolates collected in the United States, Canada, Latin America, Europe, and the Western Pacific region for the SENTRY Antimicrobial Surveillance Program 1997–1999Clin Infect Dis 2001 32:S114-S132.  [Google Scholar]

[6]Wang LF, Li JL, Ma WH, Li JY, Drug resistance analysis of bacterial strains isolated from burn patientsGenet Mol Res 2014 13:9727-34.  [Google Scholar]

[7]Wang PJ, Xie CB, Sun FH, Guo LJ, Dai M, Cheng X, Molecular characteristics of methicillin-resistant Staphylococcus epidermidis on the abdominal skin of females before laparotomyInt J Mol Sci 2016 17(6):992  [Google Scholar]

[8]Hiramatsu K, Cui L, Kuroda M, Ito T, The emergence and evolution of methicillin-resistant Staphylococcus aureusTrends Microbiol 2001 9(10):486-93.  [Google Scholar]

[9]Vitali LA, Petrelli D, Lamikanra A, Prenna M, Akinkunmi EO, Diversity of antibiotic resistance genes and staphylococcal cassette chromosome mec elements in faecal isolates of coagulase-negative staphylococci from NigeriaBMC Microbiol 2014 14:106  [Google Scholar]

[10]Havaei SA, Assadbeigi B, Esfahani BN, Hoseini NS, Rezaei N, Havaei SR, Detection of mecA and enterotoxin genes in Staphylococcus aureus isolates associated with bovine mastitis and characterization of Staphylococcal cassette chromosome mec (SCCmec) in MRSA strainsIran J Microbiol 2015 7:161  [Google Scholar]

[11]Ebrahim-Saraie HS, Motamedifar M, Sarvari J, Alfatemi SMH, Emergence of SCCmec Type I obtained from clinical samples in Shiraz teaching hospitals, South-West of IranJundishapur J Microbiol 2015 8:6  [Google Scholar]

[12]Turlej A, Hryniewicz W, Empel J, Staphylococcal cassette chromosome mec (SCCmec) classification and typing methods: an overviewPol J Microbiol 2011 60:95-103.  [Google Scholar]

[13]Machado ABMP, Reiter KC, Paiva RM, Barth AL, Distribution of staphylococcal cassette chromosome mec (SCCmec) types I, II, III and IV in coagulase-negativestaphylococci from patients attending a tertiary hospital in southern BrazilJ Med Microbiol 2007 56:1328-33.  [Google Scholar]

[14]Sawanobori E, Hung WC, Takano T, Hachuda K, Horiuchi T, Higuchi W, Emergence of Panton-Valentine leukocidin-positive ST59 methicillin-susceptible Staphylococcus aureus with high cytolytic peptide expression in associationwith community-acquired pediatric osteomyelitis complicated by pulmonary embolismJ Microbiol Immunol 2015 48:565-73.  [Google Scholar]

[15]Ruppé E, Barbier F, Mesli Y, Maiga A, Cojocaru R, Benkhalfat M, Diversity of staphylococcal cassette chromosome mec structures in methicillin-resistant Staphylococcus epidermidis and Staphylococcus haemolyticus strains amongoutpatients from four countriesAntimicrob Agents Chemother 2009 53:442-49.  [Google Scholar]

[16]Miragaia M, Carrico J, Thomas J, Couto I, Enright M, De Lencastre H, Comparison of molecular typing methods for characterization of Staphylococcus epidermidis: proposal for clone definitionJ Clin Microbiol 2008 46:118-29.  [Google Scholar]

[17]Kim SJ, Park C, Panton-Valentine leukocidin and staphylococcal cassette chromosome (SSCmec) from CA-MRSA (Community-Acquired Methicillin Resistanct Staphylococcus aureusBiomed Res 2014 25:441-44.  [Google Scholar]

[18]Havaei S, Moghadam SO, Pourmand MR, Faghri J, Prevalence of genes encoding bi-component leukocidins among clinical isolates of methicillin resistant Staphylococcus aureusIran J Public Health 2010 39:8  [Google Scholar]

[19]Alfatemi SMH, Motamedifar M, Hadi N, Saraie HSE, Analysis of virulence genes among methicillin resistant Staphylococcus aureus (MRSA) strainsJundishapur J Microbiol 2014 7:6  [Google Scholar]

[20]CLSI. Performance Standards for Antimicrobial Susceptibility Testing;Twenty-Third Informational SupplementCLSI document M100-S23 2013 Wayne, PAClinical and Laboratory Standards Institute  [Google Scholar]

[21]Oliveira CF, Paim TG, Reiter KC, Rieger A, D’azevedo PA, Evaluation of four different DNA extraction methods in coagulase-negative Staphylococci clinical isolatesRev Inst Med Trop Sao Paulo 2014 56:29-33.  [Google Scholar]

[22]Azimian A, Havaei SA, Fazeli H, Naderi M, Ghazvini K, Samiee SM, Genetic characterization of a vancomycin-resistant Staphylococcus aureus isolate from the respiratory tract of a patient in a university hospital in northeastern IranJ Clin Microbiol 2012 50:3581-85.  [Google Scholar]

[23]Namvar AE, Havaei SA, Moghim S, Lari AR, Characterization of Staphylococcus epidermidis isolates from hospitalized patients in Isfahan and Tehran teachinghospitalsMol Genet Microbiol Virol 2014 29(4):216-19.  [Google Scholar]

[24]Cherifi S, Byl B, Deplano A, Nagant C, Nonhoff C, Denis O, Genetic characteristics and antimicrobial resistance of Staphylococcus epidermidis isolates from patients with catheter-related bloodstream infections and from colonized healthcare workers in a Belgian hospitalAnn Clin Microbiol Antimicrob 2014 13:1  [Google Scholar]

[25]Havaei SA, Ghanbari F, Rastegari AA, Azimian A, Khademi F, Hosseini N, Molecular typing of hospital-acquired Staphylococcus aureus isolated from Isfahan, IranInt Sch Res Notices 2014 2014:185272  [Google Scholar]

[26]Pishva E, Havaei SA, Arsalani F, Narimani T, Azimian A, Akbari M, Detection of methicillin-resistance gene in Staphylococcus epidermidis strains isolated from patients in Al-Zahra Hospital using polymerase chain reaction and minimum inhibitory concentration methodsAdv Biomed Res 2013 2:23  [Google Scholar]

[27]Du X, Zhu Y, Song Y, Li T, Luo T, Sun G, Molecular analysis of Staphylococcus epidermidis strains isolated from community and hospital environments in ChinaPLoS One 2013 8(5):e62742  [Google Scholar]

[28]Mertens A, Ghebremedhin B, Genetic determinants and biofilm formation of clinical Staphylococcus epidermidis isolates from blood cultures and indwelling devisesEur J Microbiol Immunol(Bp) 2013 3(2):111-19.  [Google Scholar]

[29]Ito T, Kuwahara-Arai K, Katayama Y, Uehara Y, Han X, Kondo Y, staphylococcal cassette chromosome mec (SCCmec) analysis of MRSAMethods Mol Biol 2014 1085:131-48.  [Google Scholar]

[30]Kang CK, Cho JE, Choi YJ, Jung Y, Kim NH, Kim CJ, Agr dysfunction affects staphylococcal cassette chromosome mec type-dependent clinical outcomes in methicillin-resistant Staphylococcus aureus bacteremiaAntimicrob Agents Chemother 2015 59(6):3125-32.  [Google Scholar]

[31]Soroush S, Jabalameli F, Taherikalani M, Amirmozafari N, Fooladi AA, Asadollahi K, Investigation of biofilm formation ability, antimicrobial resistance and the staphylococcal cassette chromosome mec patterns of methicillin resistant Staphylococcus epidermidis with different sequence types isolated from childrenMicrob Pathog 2016 93:126-30.  [Google Scholar]

[32]Abadi MIM, Moniri R, Khorshidi A, Piroozmand A, Mousavi SG, Dastehgoli K, Molecular characteristics of nasal carriage methicillin-resistant coagulase negative Staphylococci in School studentsJundishapur J Microbiol 2015 8(6):e18591  [Google Scholar]

[33]Sani NAM, Sapri HF, Neoh H-m, Hussin S, First report on the molecular epidemiology of Malaysian Staphylococcus epidermidis isolated from a University Teaching HospitalBMC Res Notes 2014 7:597  [Google Scholar]

[34]Park HK, Woo SY, Jung YJ, Lee EO, Cha JE, Park HS, Detection of virulence genes of Staphyloccus aureus and Staphylococcus epidermidis isolated from suprapubic urine from infants with feverJ Bacteriol Virol 2008 38(4):189-96.  [Google Scholar]

[35]Abimanyu N, Krishnan A, Murugesan S, Subramanian GK, Gurumurthy S, Krishnan P, Use of triplex pcr for rapid detection of pvl and differentiation of mrsa from methicillin resistant coagulase negative staphylococciJ Clin Diagn Res 2013 7(2):215-18.  [Google Scholar]

[36]McClure JA, Conly JM, Lau V, Elsayed S, Louie T, Hutchins W, Novel multiplex PCR assay for detection of the staphylococcal virulence marker Panton-Valentine leukocidin genes and simultaneous discrimination of methicillin-susceptible from-resistant staphylococciJ Clin Microbiol 2006 44(3):1141-43.  [Google Scholar]