JCDR - Register at Journal of Clinical and Diagnostic Research
Journal of Clinical and Diagnostic Research, ISSN - 0973 - 709X
Microbiology Section DOI : 10.7860/JCDR/2017/25534.10218
Year : 2017 | Month : Jul | Volume : 11 | Issue : 7 PDF Full Version Page : DC19 - DC23

Distribution of Class D Carbapenemase and Extended-Spectrum β-Lactamase Genes among Acinetobacter Baumannii Isolated from Burn Wound and Ventilator Associated Pneumonia Infections

Maryam Mohammadi1, Setareh Soroush2, Somayeh Delfani3, Iraj Pakzad4, Abolfazl Abbaszadeh5, Mahmoud Bahmani6, Lidija Bogdanovic7, Morovat Taherikalani8

1 Clinical Microbiology Research Center, Ilam University of Medical Sciences, Ilam, Iran.
2 Razi Herbal Medicines Research Center, Department of Microbiology, School of Medicine, Lorestan University of Medical Sciences, Khorramabad, Iran.
3 Razi Herbal Medicines Research Center, Department of Microbiology, School of Medicine, Lorestan University of Medical Sciences, Khorramabad, Iran.
4 Clinical Microbiology Research Center, Ilam University of Medical Sciences, Ilam, Iran.
5 Department of Surgery, School of Medicine, Lorestan University of Medical Sciences, Khorramabad, Iran.
6 Biotechnology and Medicinal Plants Research Center, Ilam University of Medical Sciences, Ilam Iran.
7 Department of Public Health, University of Naples Federico II, Naples, Italy.
8 Razi Herbal Medicines Research Center, Department of Microbiology, School of Medicine, Lorestan University of Medical Sciences, Khorramabad, Iran.


NAME, ADDRESS, E-MAIL ID OF THE CORRESPONDING AUTHOR: Prof. Morovat Taherikalani, Razi Herbal Medicines Research Center, Department of Microbiology, School of Medicine, Khorramabad, Iran.
E-mail: taherikalani@gmail.com
Abstract

Introduction

Resistance to Acinetobacter baumannii is dramatically on the rise in Iran. Therefore, it is important to study resistance pattern among Acinetobacter isolates which is a common cause of nosocomial infections.

Aim

To investigate antibiotic resistance patterns and the role of resistant genes and biofilm formation in the induction of resistance among Acinetobacter baumannii isolated from burn wound and ventilator associated pneumonia infections.

Materials and Methods

Total 103 isolates such as 33 burn samples from Rasool Akram Hospital and 70 isolates from ventilated patients in Shahid Motahhari Hospital were identified with A. baumannii using biochemical method, and then identified to species level with PCR of gyrB and blaOXA-51 gene. Antibiotic sensitivity pattern for β-lactam and carbapenem antibiotics was assessed using Agar disc diffusion test and E-test. The presence of different carbapenemase and metalo-β-lactamase (blaOXA-51-like, gyrB, blaOXA-23-like, blaOXA-24-like, blaOXA-58, blaVEB, blaPER, blaGIM, blaSIM, blaIMP, blaVIM), extended-spectrum β-lactamases (blaTEM, blaSHV) and two insertion sequences genes (ISaba1, IS1113) was assessed. Biofilm formation of all isolates was then assessed. Chi-square analysis or Fisher’s-exact tests were used for statistical analysis. A p-value <0.05 was considered statistically significant.

Results

Colistin was the most effective antimicrobial agents, although 10.7% (11/103) of the isolates were resistant. The high rate of resistance to meropenem (93.2%) and imipenem (90.3%) was determined. Also, with exception of ampicillin-sulbactam, surprisingly the resistant rate was 28.2%, the resistance to β-lactam antibiotic was dramatically increased. Co-existence of two and three blaOXA genes was also determined. The blaOXA-58 was detected in only one isolate. The blaTEM and blaOXA-23 was the most prevalent Extended-Spectrum β-Lactamases (ESBL) gene. All isolates were biofilm producers.

Conclusion

Antibiotic resistance is increasing among A. baumannii isolates which is due to excessive use of antibiotics and also acquired resistant genes and biofilm production. Resistance to nearly all antimicrobial agents especially colistin as end choice for treatment of multiple drug resistance A. baumannii is a big concern.

Keywords

β–lactams, Insertion elements, Nosocomial infections

Introduction

Genus Acinetobacter are cause of infections in hospitalised patients and especially those in Intensive Care Unit (ICU) [1]. Due to Acinetobacter spp. biofilm producing ability, they survive longer on dry surfaces or on instruments and disseminate in hospital environments and cause nosocomial infections [2]. This organism is the cause of hospital infections which occur in most disabled ICU patients. Presence of resistance genes among in Acinetobacter spp. make them more prevalent in healthcare settings [3]. The most common Acinetobacter spp. isolated from human samples is Acinetobacter baumannii [4].

This bacterium is resistant to many available antibiotics because it has been in contact with other gram-negative bacteria in hospital environments and also exposed to extensive bombardment with antibiotics, so most strains of A. baumannii are resistant to ampicillin, tetracycline, rifampin, amoxicillin/clavulanic acid, macrolides, anti-staphylococcal penicillin, and wide range cephalosporins except for cefepime, ceftazidime, and chloramphenicol [5]. Therefore, it can acquire resistance mechanisms from plasmids, integrons, transposons, and other gram-negatives, in addition to its inherent tendency to acquire resistance [3].

Today, Multiple Drug Resistance (MDR) and especially Extensively-Drug Resistant (XDR) pathogen are global issues [1]. Usually it is called MDR Acinetobacter when it is resistant to three or more groups of antibiotics or to one key treatment antibiotic, and is Pan Drug-Resistant (PDR) Acinetobacter when it is resistant to all available groups of antibiotics for the experimental treatment of its infections [6].

Emergence of β-lactamases among bacteria has caused resistance in many bacteria responsible for hospital infections, and has therefore caused serious problems in treating bacterial infections [7]. Production of carbapenemase is mostly the mechanism for resistance to carbapenems. Carbapenem resistance in A. baumannii is mediated by presence of blaOXA-23, blaOXA-24-, and blaOXA-58 type of class D family of serine β-lactamases and IMP/VIM class B of metallo-β-lactamases [8]. Mostly the isolates of Acinetobacter spp. have multiple copies of Insertion Sequence (IS) [9]. ISAba1 and other IS, are on the upstream of OXA type class D carbapenemases and modulates the expression and transfer of OXA-type carbapenemase genes [10]. Resistance of antimicrobial agents among clinical isolates may add to the burden of treating infections and also negatively affect clinical results and treatment costs [2,11].

In addition to the ability to acquire resistance indicators by strains of A. baumannii, another issue adding to the clinical importance of these bacteria in the last 15 years which threatens antibiotic therapy is their ability to form biofilm [12]. In fact, biofilm formation ability is an important strategy in their survival, and increases their resistance to antimicrobial compounds under stress such as host defense or antibiotic use [13].

The present study was conducted in Rasool Akram and Shahid Motahhari Hospitals in order to determine the frequency of resistance to β-lactam antibiotics; the prevalence of different β-lactamases genes and relationship between expression of antibiotic resistance and biofilm formation in strains of A. baumannii isolated from burn wounds and Ventilator Associated Pneumonia (VAP) infections.

Materials and Methods

Studied Population, Phenotypic and Genotypic Confirmation of Isolates

This prospective study was conducted from April 2015 to March 2016. Total 103 Acinetobacter isolates consisting of 33 burn samples (swab) from Rasool Akram Hospital (Tehran city) and 70 isolates from ventilated patients in Shahid Motahhari Hospital (Tehran city) were collected. After culturing isolates on nutrient media (Conda, Spain), routine tests such as growth in 45°C and 37°C and producing acid in Oxidative/Fermentation glucose (OF glucose) (Conda, Spain) were conducted to identify A. baumannii species. Inherent genes of Acinetobacter strains including blaOXA-51-like and gyrB were tested using PCR for genotypic confirmation of isolates. After genotypic and phenotypic confirmation of samples, isolates were moved to an environment of 15% glycerol and 5% liquid Brain-Heart Infusion (BHI) medium (Conda, Spain) for storage and preservation at -70°C.

Antimicrobial Susceptibility Testing

Antibiotic sensitivity pattern with antibiotic disks (Mast, UK) imipenem (10 μg), meropenem (10 μg), cefepime (30 μg), piperacillin/tazobactam (100/10 μg), ampicillin/sulbactam (10/10 μg), piperacillin (100 μg), ticarcillin/clavulanic acid (75/10 μg), ceftazidime (30 μg), and ceftriaxone (30 μg) was assessed using agar disc diffusion test according to the recommendations and definitions of the manufacturers and CLSI 2015 guidelines [14]. Minimum Inhibitory Concentration (MIC) against Colistin was determined using E-test (AB BIODISK, Sweden). Escherichia coli ATCC® 25922 and ATCC® 35218 and Pseudomonas aeruginosa ATCC® 27853 were used as quality controls in each susceptibility determination.

Determining of Antibiotic Resistant Genes and Insertion Elements

PCR for determining the presence of 15 different β-lactamases, blaOXA-51-like, gyrB, ISaba1, blaOXA-23-like, blaOXA-24-like,blaOXA-58,blaTEM, blaSHV, blaVEB, blaPER, blaGIM, blaSIM, blaIMP, blaVIM, IS1113 genes were carried out. Primers used to identify genes were listed in [Table/Fig-1]. A. baumannii NCTC 12156, NCTC 13302, NCTC 13303, NCTC 13304 were used as standard control for blaOXA-51, blaOXA-23, blaOXA-24 and blaOXA-58 genes respectively. For IS1113 gene was repeated twice. For all other PCR amplification, the product obtained were considered positive based on amplification size and direct sequencing of selected amplicons. In negative result, PCR amplification was repeated at least twice for these genes.

Sequences of the primers used in the study.

GeneNucleotide sequence (5’-3’)Amplicon size (bp)Annealing temp (°C)References
blaOXA-51-likeFTAATGCTTTGATCGGCCTTG35353[15]
RTGGATTGCACTTCATCTTGG
gyrBFCACGCCGTAAGAGTGCATTA29457.2[16]
RAACGGAGCTT-GTCAGGGTTA
TGG CAC TTC ACT ATC AAT AC490
ISAba1FATGCAGCGCTTCTTTGCAGG39355[15]
RAATGATTGGTGACAATGAAG
blaOXA-23-likeFTCTGGTTGTACGGTTCAGC50153[17]
RAGTCTTTCCAAAAATTTTG
blaOXA-24-likeFATGAAAAAATTTATACTTCC24653[18]
RTTAAATGATTCCAAGATTTTC
blaOXA-58FATGAAATTATTAAAAATATTGAGTTTAG59953[18]
RTTATAAATAATGAAAAACACCCAAC
blaTEMFGCACGAGTGGGTTACATCGA31051[15]
RGGTCCTCCGATCGTTGTCAG
blaSHVFATGCGTTATATTCGCCTGTG75345[15]
RTGCTTTGTTATTCGGGCCAA
blaVEBFATGAAAATCGTAAAAAGGATATT78047[15]
RTTATTTATTCAAATAGTAATTCC
blaPERFATGAATGTCATTATAAAAG92744[15]
RTTGGGCTTAGGGCAG
blaGIMFATATTACTTGTAGCGTTGCCAGC72953[15]
RTTAATCAGCCGACGCTTCAG
blaSIMFTACAAGGGATTCGGCATCG74159[19]
RTAATGGCCTGTTCCCATGTG
blaIMPFGTTTATGTTCATACWTCG43256[15]
RGGTTTAAYAAAACAACCAC
blaVIMFTTTGGTCGCATATCGCAACG50062[15]
RCCATTCAGCCAGATCGGCAT
IS1113FATGACACATCTCAATGAGTTATAT54358[18]
RTTAACACGAATGCAGAAGTTGATG

PCR was carried out with 50 ng of the template DNA, 10 pmol of each primer, 1 X PCR buffer, 2.5 mM MgCl2, 0.2 mM dNTP mix, and 1U of Taq DNA polymerase (Fermentas, Lithuania) in a total volume of 25 μl. PCR amplification was carried out under the following conditions: 30 cycles of denaturation at 95°C for 30 seconds, annealing at primer set specific temperatures for one minute, and extension at 72°C for one minute followed by a final extension cycle at 72°C for 10 minute. PCR products were resolved on 1.0% agarose gels (Roche, Switzerland), stained with ethidium bromide and photographed with UV illumination.

Biofilm Formation Assay

First, an 18-24 hour colony was added to a tube with Lysogeny Broth medium (LB medium) (Conda, Spain). After 18-24 hour of incubation, its concentration was regulated to use to spectrophotometer at 650 nm, 0.1-0.08. About 190 μl of LB medium and 10 μl of microbial suspension were added into each well of a 96-well microplate and incubated in 37°C for 24-48 hour.

Biofilm formation assay was conducted three times for each bacterium. Negative control for each bacterium had 200 μl of LB medium. After rinsing microplates with distilled water, each well was stained using 0.1% crystal violet for 10 minute at room temperature, and then rinsed three more times with distilled water.

In the last step, 200 μl of 95% ethanol was added to each well, and light absorption at 492 nm was assessed using ELISA reader. Light absorption values were considered as indicators of bacteria’s link to the surface and formation of biofilm. For quantitative analysis of biofilm formation, mean light absorption of three wells (A) was calculated, compared with that of a control well (Ac), and then assessed as: no biofilm formation, A ≤ Ac; weak biofilm formation, Ac < A ≤ (2×Ac); average biofilm formation, (2×Ac) < A ≤ (4×Ac); and strong biofilm formation, (4×Ac) < A.

Statistical Analysis

Chi-square analysis and Fisher’s exact test using SPSS, version 21.0. were employed for statistical analyses. A p-value < 0.05 were employed as statistically significant.

Results

Antimicrobial Susceptibility Test

All 103 samples had inherent gyrB and blaOXA-51 genes, identified as A. baumannii. These isolates were 93.2% resistant to meropenem, 90.3% to imipenem, 88.3% to cefepime, 87.4% to ceftazidime, 82.4% to ceftriaxone. The highest resistance in clinical isolates of A. baumannii was against meropenem (93.2%), and the lowest resistance was against ampicillin/sulbactam (28.2%). MIC range for colistin was 0.064 μg/ml to 1024 μg/ml of concentration, and MIC50 for ventilated patients and MIC90 for burn patients were 0.125 μg /ml and 0.5 μg /ml for this antibiotic respectively [Table/Fig-2].

Results of MIC determination for colistin using E-test method.

ColistinMIC ranges (μg/mml)MIC50 (μg/mml)MIC90 (μg/mml)ResistantMIC≥ 4μg/mlSusceptibleMIC≤ 2μg/mlTotal
No%No%No%
Burn0.19- 80.380.513329733100
Ventilator0.125-80.12581014.26085.770100
Total0.125-80.3881110.79289.3103100

Frequency of Antibiotic-resistant and Insertion Elements Genes

Frequencies of blaOXA-23, blaOXA-24, blaOXA-58, blaTEM, and blaPER genes were 90.3%, 38.9%, 1%, 60.2%, and 18.5% respectively. The blaTEM and blaOXA-23 genes had the highest frequencies. In this study, blaGIM, blaVIM, blaIMP, blaSIM, blaVEB, and blaSHV genes were not identified [Table/Fig-3].

Percentage of antibiotic-resistant genes and insertion elements according to sample origin.

GenesSampleblaOXA-23blaOXA-24blaOXA-58blaPERblaTEMISaba1IS1113
Burn32%7.8%1%4.9%30.1%28.2%22.3%
VAP58.3%31.1%0%13.6%30.1%41.7%34%

Based on statistical analysis, there is a significant relationship between the presence of blaTEM gene and resistance to ceftriaxone and ceftazidime (p=0.01). A high level of resistance to these two antibiotics was observed in strains where this gene was present. Statistical analysis show a significant relationship between the presence of blaOXA-23 and resistance to imipenem (p=0.04) and meropenem (p=0.01). Analysis also show a significant relationship between the presence of blaOXA-24 and resistance to Imipenem (p=0.02), while no significant relationship was observed between the presence of this gene and resistance to Meropenem (p=0.08).

A 69.9% and 56.3% of strains had ISAba-1 and IS1113 insertion elements respectively. Statistical analysis demonstrated a significant relationship between the presence of ISAba1 insertion elements and resistance to imipenem, meropenem, and ceftazidime (p=0.01).

Investigating the frequency of oxacillinase genes in A. baumannii strains resistant to carbapenem showed there were only three samples with blaOXA-51 gene and without other carbapenemase genes which did not show any resistance to carbapenem. Here, 57.3% of strains with only blaOXA-23 oxacillinase gene and without other oxacillinase genes were resistant to both imipenem or meropenem and one of them which indicates the prominent role of this gene in resistance to carbapenem in A. baumannii. In 32%, both blaOXA-24 and blaOXA-23 were present; 31.1% of these strains were resistant to both or one of carbapenems. The simultaneous presence of blaOXA-58 and blaOXA-23 was seen in 1 strain which was resistant to both carbapenems. No simultaneous presence of blaOXA-58 and blaOXA-24 was observed [Table/ Fig-4].

Frequency of oxacillinase genes in carbapenem-resistant strains of A. baumannii

Oxacillinase geneFrequency (%)Only Resistant to ImipenemOnly Resistant to MeropenemResistance to bothTotal %
blaOXA-513 (2.9)0 (0)0 (0)0 (0)0
blaOXA-2359 (57.3)0 (0)5 (4.9)51 (49.5)54.4
blaOXA-247 (6.8)0 (0)2 (1.9)5 (4.9)6.8
blaOXA-580 (0)0 (0)0 (0)0 (0)0
blaOXA-23/24like33 (32)1 (1)3 (4.9)27 (26.2)31.1
blaOXA-23/58like1 (1)0 (0)0 (0)1 (1)1

Biofilm Formation

Results of biofilm formation study showed that all (100%) isolated strains tended to form biofilm. Frequency of ability of strong biofilm, average biofilm and weak biofilm formation in clinical A. baumannii strains were 37.8%, 37.9% and 24.3% respectively. In this study, biofilm formation was investigated in resistant, intermediate and sensitive strains; based on results and on statistical analysis, there was no significant relationship between the amount of biofilm formation using microtiter plate and resistance to studied antibiotics (p=0.13). Nevertheless, the amount of biofilm formation was higher in resistant strains compared with sensitive strains [Table/Fig-5].

Relationship between the amount of biofilm formation using microtiter plate and resistance to studied antibiotics.

AntibioticType of sensitivityStrong biofilmAverage biofilmWeak biofilm
ImipenemResistant32%35%23.2%
Intermediate1%0%0%
Sensitive4.9%1%2.9%
MeropenemResistant%350%23.3%
Intermediate0%35%0%
Sensitive2.9%1%2.9%
CefepimeResistant32%35%21.4%
Intermediate0%1%1%
Sensitive5.8%0%3.9%
PiperacillinResistant31.1%31.1%18.4%
Intermediate1%0%4.2%
Sensitive5.8%4.9%2.9%
CeftazidimeResistant31.1%34%22.3%
Intermediate3.9%0%2.9%
Sensitive2.9%1.9%%1
CeftriaxoneResistant29.1%32%21.4%
Intermediate3.9%1.9%1.9%
Sensitive4.9%1.9%2.9%
TazobactamResistant30.1%34%18.4%
Intermediate1%0%0%
Sensitive6.8%1.9%7.8%
Ampicillin/sulbactamResistant16.5%7.8%3.2%
Intermediate1%25.2%%1
Sensitive20.4%2.9%21.4%
Clavulanic acid-tazobactamResistant29.1%31.1%18.4%
Intermediate1%0%1.9%
Sensitive7.8%4.9%5.8%
ColistinResistant1.9%1.9%6.8%
Intermediate0%0%0%
Sensitive35%34%19.4%

Discussion

A. baumannii shows resistance to most β-lactam antibiotics and quinolones due to its ability to survive in hospital environments, create resistance mechanism, and cause severe infections in patients. Its resistance to aminoglycosides is also emerging [19,20]. Extensive use of antibiotics has increased antibiotic resistance in this bacterium, so it is reported to be resistant to β-lactamases all over the world [21]. Wide range β-lactamases have different prevalence rates not only among different countries, but also in various geographical regions of one country [22]. Results of blaOXA-51 gene proliferation in this study showed that it existed in all isolates. Prevalence of blaOXA-51 among strains of A. baumannii has been reported by various studies to be 84.37% in Iran [23], 50% in Taiwan [24], 82.94% in UK [25] and 100% in a study from Iran [26]. In addition to the blaOXA-51 gene PCR, results of gyrB gene PCR were also used in this study for genotypic confirmation. Results of gyrB gene proliferation demonstrated that it was present in all isolates, perfectly compatible with Higgins P et al., [16]. According to our results, PCR detection of gyrB gene can be a cheaper, easier, and more accurate method compared to other genotypic-based diagnosis methods.

The highest antibiotic resistance observed in this study was against Imipenem (90.3%) and Meropenem (93.2%) which increased over time. Moradi J et al., in their review reported resistance to Imipenem and Meropenem in Iran in 2012-2014 to be 76.5% and 81.5% respectively which was increased over time [27]. Their study showed that many species of A. baumannii have at least two carbapenemase genes simultaneously: blaOXA-51 which is inherent to this bacterium; blaOXA-58, blaOXA-24, and blaOXA-23 which are acquired.

In the present study, blaOXA-23 gene was present in 90.3% of A. baumannii strains. In another study done by Sohrabi N et al., blaOXA-23 was reported in 88.7% of imipenem resistant strains, which was closer to our results [28]. The high prevalence of blaOXA-23 is compatible with global reports which estimate it to be 70-100% [26,29,30].

In our study, 38.9% of strains had blaOXA-24 and 1% had blaOXA-58. 32% carried both blaOXA-24 and blaOXA-23, and 1% carried blaOXA-58 and blaOXA-23. All resistant or sensitive strains carried blaOXA-51. In another study, none of the strains had blaOXA-24/40, and ISAba1-OXA-51 was found in four strains without any blaOXA-58,blaOXA-23, or blaOXA-40 genes [31].

Different results of studies can be attributed to assessment of different hospitals. Studies from all over the world show that numerous geographical differences have been observed in molecular epidemiology of carbapenemase genes. In the present study, 54.4% of strains with only blaOXA-23 oxacillinase gene and without other oxacillinase genes were resistant to both imipenem or meropenem or one of them indicating the prominent role of this gene in resistance or decreasing sensitivity of A. baumannii against carbapenems. Of course, we must consider three strains which were sensitive to both carbapenems in spite of carrying carbapenemase gene, similar to a study from China in which, 14 carbapenem sensitive A. baumannii strains harboring the blaOXA−51 like gene showed no resistance to carbapenem drugs [32]. Since resistance to Ceftazidime, Imipenem, and Meropenem was also high in this study strains were investigated for the presence of insertion elements as well. Results showed that 69.9% and 56.3% of strains had ISAba1 and IS1113 insertion elements respectively.

Sohrabi N et al., reported the prevalence of ISAba1 gene to be 90% in Iran [28]. Moreover, its prevalence was reported to be 69% by Rezaee MA et al., [33]. In addition, a 2010 study in 10 hospitals in Taiwan showed that 40.2% of 291 A. baumannii isolates included ISAba1, and the prevalence of blaOXA-51ISAba1 insertion element differed between 6.7% to 64.3% in different hospitals [34].

In the present study, blaGIM, IMP, SIM and blaVIM genes were assessed using PCR in order to investigate the role of metallo-β-lactamases and determine the frequency of productive strains. As expected, none of these genes were identified.

In a study from Tehran, Shahcheraghi F et al., reported that 9% of Acinetobacter produced metallo-β-lactamase (using combined disk method), yet no gene was separated in PCR [35]; no class B metallo-β-lactamase genes, including bla, IMP, blaVIM were observed [36], compatible with our results, showing the low frequency of this class of β-lactamases.

In the present study, biofilm-forming strains had, 93.2% to Meropenem, 90.3% resistance to Imipenem, 88.3% to cefepime, 87.4% to ceftazidime, 82.4% to ceftriaxone, and 82.5% to tazobactam, and it seems that biofilm-forming strains show a high resistance. Nonetheless, no significant relationship was seen between biofilm formation and level of resistance, in contrast to results of Rodríguez Baño J et al., who had found a low resistance in biofilm-forming strains [37].

A similar study on the relationship between biofilm formation ability and level of resistance was carried out in 2013 in Bangladesh. A total 66% of strains could form biofilm and were 81%, 100%, 100%, and 7% resistant to Imipenem, Ceftazidime, Ceftriaxone, and Colistin respectively [38].

The present study showed a decreased sensitivity to most available antimicrobial agents for the treatment of Acinetobacter infections, except for Colistin and Ampicillin/sulbactam, which can be introduced as choice drugs for treating resistant strains. Among Imipenem- and Meropenem-resistant strains, 54.4% carried blaOXA-23; therefore, the high prevalence of class D carbapenemases among these isolates may be responsible for resistance to studied carbapenems.

Investigating biofilm formation pattern showed that all strains could form biofilm. Since ventilators are highly involved in Acinetobacter infections, disinfection and sterilization of respiratory equipment and devices can be one way to prevent dissemination of these infections.

Limitation

In present study, the sample size was very small to conclude significant results also, only burn and VAP cases were included which do not reveal much about the resistant genes distribution in other infections caused by Acinetobacter baumannii. Also, pattern of spread of resistance among isolates was not studied in current study which would help in infection control. Thus, further studies are needed to be done to study resistance spread pattern among isolates to control such infections in healthcare settings.

Conclusion

The present study showed that the presence of insertion elements, co-existence of two or more resistance genes and biofilm producing genes, increases the resistance of isolates. blaOXA-23 and blaTEM are major resistance gene among Acinetobacter isolates. Colistin and ampicillin/sulbactam are treatment choices left for such resistant isolates. Finally, due to extension of antibiotic resistance, identified by the current study, performance of a precise and regular national program to control the immethodical consumption of antibiotics is suggested.

Financial or other Competing Interests

None.

References

[1]Peleg AY, Seifert H, Paterson DL, Acinetobacter baumannii: emergence of a successful pathogenClin Microbiol Rev 2008 21(3):538-82.  [Google Scholar]

[2]Espinal P, Marti S, Vila J, Effect of biofilm formation on the survival of Acinetobacter baumannii on dry surfacesJ Hospital Infect 2012 80(1):56-60.  [Google Scholar]

[3]Roca I, Espinal P, Vila-Farrés X, Vila J, The Acinetobacter baumannii oxymoron: commensal hospital dweller turned pan-drug-resistant menaceFront Microbiol 2012 23(3):148  [Google Scholar]

[4]Bouvet PJ, Grimont PA, Taxonomy of the genus Acinetobacter with the recognition of Acinetobacter baumannii sp. nov., Acinetobacter haemolyticus sp. nov., Acinetobacter johnsonii sp. nov., and Acinetobacter junii sp. nov. and emended descriptions of Acinetobacter calcoaceticus and Acinetobacter lwoffiiInt J Syst Evol Microbiol 1986 36(2):228-40.  [Google Scholar]

[5]Landman D, Quale JM, Mayorga D, Adedeji A, Vangala K, Ravishankar J, Citywide clonal outbreak of multiresistant Acinetobacter baumannii and Pseudomonas aeruginosa in Brooklyn, NY: the preantibiotic era has returnedArch Intern Med 2002 162(13):1515-20.  [Google Scholar]

[6]Magiorakos AP, Srinivasan A, Carey R, Carmeli Y, Falagas M, Giske C, Multidrug-resistant, extensively drug-resistant and pandrug-resistant bacteria: an international expert proposal for interim standard definitions for acquired resistanceClini Microbiol Infect 2012 18(3):268-81.  [Google Scholar]

[7]Paterson DL, Resistance in gram-negative bacteria: EnterobacteriaceaeAmerican J Med 2006 119(6):20-28.  [Google Scholar]

[8]Poirel L, Pitout JD, Nordmann P, Carbapenemases: molecular diversity and clinical consequencesFuture Microbiol 2007 2:501-12.  [Google Scholar]

[9]Mugnier PD, Poirel L, Nordmann P, Functional analysis of insertion sequence ISAba1, responsible for genomic plasticity of Acinetobacter baumanniiJ Bacteriol 2009 191:2414-18.  [Google Scholar]

[10]Zander E, Nemec A, Seifert H, Higgins PG, Association between β-lactamase-encoding blaOXA-51 variants and DiversiLab rep-PCR-based typing of Acinetobacter baumannii isolatesJ ClinMicrobiol 2012 50(6):1900-04.  [Google Scholar]

[11]Carmeli Y, Troillet N, Eliopoulos GM, Samore MH, Emergence of antibiotic-resistant Pseudomonas aeruginosa: comparison of risks associated with different antipseudomonal agentsAntimicrob Agent Chemother 1999 43(6):1379-82.  [Google Scholar]

[12]Rao RS, Karthika RU, Singh S, Shashikala P, Kanungo R, Jayachandran S, Correlation between biofilm production and multiple drug resistance in imipenem resistant clinical isolates of Acinetobacter baumanniiIndian J Med Microbiol 2008 26(4):333  [Google Scholar]

[13]Gurung J, Khyriem AB, Banik A, Lyngdoh WV, Choudhury B, Bhattacharyya P, Association of biofilm production with multidrug resistance among clinical isolates of Acinetobacter baumannii and Pseudomonas aeruginosa from intensive care unitIndian Journal of Crit Care Med 2013 17(4):214  [Google Scholar]

[14]CLSI. Performance Standards for Antimicrobial Susceptibility Testing; Twenty-Fifth Informational Supplement. CLSI document M100-S25. Wayne, PA: Clinical and Laboratory Standards Institute; 2015  [Google Scholar]

[15]Asadollahi P, Akbari M, Soroush S, Taherikalani M, Asadollahi K, Sayehmiri K, Antimicrobial resistance patterns and their encoding genes among Acinetobacter baumannii strains isolated from burned patientsBurns 2012 38(8):1198-203.  [Google Scholar]

[16]Higgins P, Wisplinghoff H, Krut O, Seifert H, A PCR-based method to differentiate between Acinetobacter baumannii and Acinetobacter genomic species 13TUClin Microbiol Infect 2007 13(12):1199-201.  [Google Scholar]

[17]Biglari S, Alfizah H, Ramliza R, Rahman MM, Molecular characterization of carbapenemase and cephalosporinase genes among clinical isolates of Acinetobacter baumannii in a tertiary medical centre in MalaysiaJ Med Microbiol 2015 64(1):53-58.  [Google Scholar]

[18]Srinivasan VB, Rajamohan G, Pancholi P, Stevenson K, Tadesse D, Patchanee P, Genetic relatedness and molecular characterization of multidrug resistant Acinetobacter baumannii isolated in central Ohio, USAAnn Clin Microbiol Antimicrob 2009 8(1):1  [Google Scholar]

[19]Poirel L, Walsh TR, Cuvillier V, Nordmann P, Multiplex PCR for detection of acquired carbapenemase genesDiagn Microbiol Infect Dis 2011 70(1):119-23.  [Google Scholar]

[20]Van Looveren M, Goossens H, Antimicrobial resistance of Acinetobacter spp. in EuropeClin Microbiol Infect 2004 10(8):684-704.  [Google Scholar]

[21]Shah AA, Hasan F, Ahmed S, Hameed A, Characteristics, epidemiology and clinical importance of emerging strains of Gram-negative bacilli producing extended-spectrum β-lactamasesRes Microbiol 2004 155(6):409-21.  [Google Scholar]

[22]Fazeli H, Hosseini MM, Mohammadi GP, Frequency and resistance pattern of extended spectrum beta lactamase producing Escherichia coli in clinical specimen of Alzahra hospital in Isfahan, IranJ Shahrekord Univ Med Sci 2009 10(4):58-64.  [Google Scholar]

[23]Feizabadi M, Fathollahzadeh B, Taherikalani M, Rasoolinejad M, Sadeghifard N, Aligholi M, Antimicrobial susceptibility patterns and distribution of blaOXA genes among Acinetobacter spp. Isolated from patients at Tehran hospitalsJpn J Infect Dis 2008 61(4):274-78.  [Google Scholar]

[24]Lee YT, Fung CP, Wang FD, Chen CP, Chen TL, Cho WL, Outbreak of imipenem-resistant Acinetobacter calcoaceticusAcinetobacter baumannii complex harboring different carbapenemase gene-associated genetic structures in an intensive care unitJournal of Microbiology, Immunol Infect 2012 45(1):43-51.  [Google Scholar]

[25]Turton JF, Woodford N, Glover J, Yarde S, Kaufmann ME, Pitt TL, Identification of Acinetobacter baumannii by detection of the blaOXA-51-like carbapenemase gene intrinsic to this speciesJ Clin Microbiol 2006 44(8):2974-76.  [Google Scholar]

[26]Mohammadi F, Goudarzi H, Hashemi A, Nojookambari NY, Khoshnood S, Sabzehali F, Detection of ISAba1 in acinetobacter baumannii strains carrying oxa genes isolated from Iranian burns patientsArchives of Pediatric Infectious Diseases 2016 5(2):e39307  [Google Scholar]

[27]Moradi J, Hashemi FB, Bahador A, Antibiotic resistance of Acinetobacter baumannii in Iran: a systemic review of the published literatureOsong Public Health Res Perspect 2015 6(2):79-86.  [Google Scholar]

[28]Sohrabi N, Farajnia S, Akhi MT, Nahaei MR, Naghili B, Peymani A, Prevalence of OXA-type β-lactamases among Acinetobacter baumannii isolates from Northwest of IranMicrob Drug Res 2012 18(4):385-89.  [Google Scholar]

[29]Andriamanantena TS, Ratsima E, Rakotonirina HC, Randrianirina F, Ramparany L, Carod JF, Dissemination of multidrug resistant Acinetobacter baumannii in various hospitals of Antananarivo MadagascarAnn Clin Microbiol Antimicrob 2010 9(1):1  [Google Scholar]

[30]Mendes RE, Bell JM, Turnidge JD, Castanheira M, Jones RN, Emergence and widespread dissemination of OXA-23,-24/40 and-58 carbapenemases among Acinetobacter spp. in Asia-Pacific nations: report from the SENTRY Surveillance ProgramJ Antimicrob Chemother 2009 63(1):55-59.  [Google Scholar]

[31]Taherikalani M, Bahram F, Mohammad E, Setareh S, Mehdi FM, Distribution of different carbapenem resistant clones of Acinetobacter baumannii in Tehran hospitalsNew Microbiol 2009 32(3):265  [Google Scholar]

[32]Wong MH, Li Y, Chan EW, Chen S, Functional categorization of carbapenemase-mediated resistance by a combined genotyping and two-tiered Modified Hodge Test approachFront. Microbiol 2015 6:293  [Google Scholar]

[33]Rezaee MA, Pajand O, Nahaei MR, Mahdian R, Aghazadeh M, Ghojazadeh M, Prevalence of Ambler class A β-lactamases and ampC expression in cephalosporin-resistant isolates of Acinetobacter baumanniiDiagn Microbiol Infect Dis 2013 76(3):330-34.  [Google Scholar]

[34]Chen TL, Lee YT, Kuo SC, Hsueh PR, Chang FY, Siu LK, Emergence and distribution of plasmids bearing the blaOXA-51-like gene with an upstream ISAba1 in carbapenem-resistant acinetobacter baumannii isolates in TaiwanAntimicrob Agents Chemother 2010 54(11):4575-81.  [Google Scholar]

[35]Shahcheraghi F, Abbasalipour M, Feizabadi M, Ebrahimipour G, Akbari N, Isolation and genetic characterization of metallo-β-lactamase and carbapenamase producing strains of Acinetobacter baumannii from patients at Tehran hospitalsIran J Microbiol 2011 3(2):68-74.  [Google Scholar]

[36]Stoeva T, Higgins PG, Savov E, Markovska R, Mitov I, Seifert H, Nosocomial spread of OXA-23 and OXA-58 β-lactamase-producing Acinetobacter baumannii in a Bulgarian hospitalJ Antimicrob Chemother 2009 63(3):618-20.  [Google Scholar]

[37]Rodriguez-Bano J, Marti S, Soto S, Fernández–Cuenca F, Cisneros JM, Pachon J, Biofilm formation in Acinetobacter baumannii: associated features and clinical implicationsClin Microbiol Infect 2008 14(3):276-78.  [Google Scholar]

[38]Nahar A, Anwar S, Miah MRA, Association of biofilm formation with antimicrobial resistance among the acinetobacter species in a tertiary care hospital in BangladeshJ Med 2013 14(1):28-32.  [Google Scholar]